MFGE8 (NM_001114614) Human Untagged Clone
CAT#: SC318831
MFGE8 (untagged)-Human milk fat globule-EGF factor 8 protein (MFGE8), transcript variant 2
"NM_001114614" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MFGE8 |
Synonyms | BA46; EDIL1; HMFG; hP47; HsT19888; MFG-E8; MFGM; OAcGD3S; SED1; SPAG10 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001114614 edited
ATGCCGCGCCCCCGCCTGCTGGCCGCGCTGTGCGGCGCGCTGCTCTGCGCCCCCAGCCTC CTCGTCGCCCTGGATATCTGTTCCAAAAACCCCTGCCACAACGGTGGTTTATGCGAGGAG ATTTCCCAAGAAGTGCGAGGAGATGTCTTCCCCTCGTACACCTGCACGTGCCTTAAGGGC TACGCGGGCAACCACTGTGAGACGAAATGTGTCGAGCCACTGGGCATGGAGAATGGGAAC ATTGCCAACTCACAGATCGCCGCCTCATCTGTGCGTGTGACCTTCTTGGGTTTGCAGCAT TGGGTCCCGGAGCTGGCCCGCCTGAACCGCGCAGGCATGGTCAATGCCTGGACACCCAGC AGCAATGACGATAACCCCTGGATCCAGGTGAACCTGCTGCGGAGGATGTGGGTAACAGGT GTGGTGACGCAGGGTGCCAGCCGCTTGGCCAGTCATGAGTACCTGAAGGCCTTCAAGGTG GCCTACAGCCTTAATGGACACGAATTCGATTTCATCCATGATGTTAATAAAAAACACAAG GAGTTTGTGGGTAACTGGAACAAAAACGCGGTGCATGTCAACCTGTTTGAGACCCCTGTG GAGGCTCAGTACGTGAGATTGTACCCCACGAGCTGCCACACGGCCTGCACTCTGCGCTTT GAGCTACTGGGCTGTGAGCTGAACGGATGCGCCAATCCCCTGGGCCTGAAGAATAACAGC ATCCCTGACAAGCAGATCACGGCCTCCAGCAGCTACAAGACCTGGGGCTTGCATCTCTTC AGCTGGAACCCCTCCTATGCACGGCTGGACAAGCAGGGCAACTTCAACGCCTGGGTTGCG GGGAGCTACGGTAACGATCAGTGGCTGCAGATCTTCCCTGGCAACTGGGACAACCACTCC CACAAGAAGAACTTGTTTGAGACGCCCATCCTGGCTCGCTATGTGCGCATCCTGCCTGTA GCCTGGCACAACCGCATCGCCCTGCGCCTGGAGCTGCTGGGCTGTTAG |
Restriction Sites | Please inquire |
ACCN | NM_001114614 |
Insert Size | 1000 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001114614.1, NP_001108086.1 |
RefSeq Size | 1849 bp |
RefSeq ORF | 1008 bp |
Locus ID | 4240 |
Cytogenetics | 15q26.1 |
Gene Summary | 'This gene encodes a preproprotein that is proteolytically processed to form multiple protein products. The major encoded protein product, lactadherin, is a membrane glycoprotein that promotes phagocytosis of apoptotic cells. This protein has also been implicated in wound healing, autoimmune disease, and cancer. Lactadherin can be further processed to form a smaller cleavage product, medin, which comprises the major protein component of aortic medial amyloid (AMA). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]' Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225489 | MFGE8 (Myc-DDK-tagged)-Human milk fat globule-EGF factor 8 protein (MFGE8), transcript variant 2 |
USD 420.00 |
|
RG225489 | MFGE8 (GFP-tagged) - Human milk fat globule-EGF factor 8 protein (MFGE8), transcript variant 2 |
USD 460.00 |
|
RC225489L3 | Lenti ORF clone of Human milk fat globule-EGF factor 8 protein (MFGE8), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC225489L4 | Lenti ORF clone of Human milk fat globule-EGF factor 8 protein (MFGE8), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review