SH3BP2 (NM_001122681) Human Untagged Clone

CAT#: SC318934

SH3BP2 (untagged)-Human SH3-domain binding protein 2 (SH3BP2), transcript variant 2


  "NM_001122681" in other vectors (6)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SH3BP2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SH3BP2
Synonyms 3BP-2; 3BP2; CRBM; CRPM; RES4-23
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001122681, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCTGAAGAGATGCATTGGCCTGTCCCTATGAAGGCCATTGGTGCCCAGAACCTGCTAACCATGC
CTGGGGGCGTGGCCAAGGCTGGCTACCTGCACAAGAAGGGCGGTACCCAGCTGCAGCTGCTGAAATGGCC
CCTGCGCTTTGTCATCATCCACAAACGCTGCGTCTACTACTTCAAGAGTAGCACCTCTGCCTCCCCGCAG
GGCGCCTTCTCCCTGAGTGGCTATAACCGGGTGATGCGGGCGGCTGAGGAGACCACGTCCAACAACGTTT
TCCCCTTCAAGATCATCCATATCAGCAAGAAGCACCGCACGTGGTTCTTCTCGGCCTCCTCCGAGGAGGA
GCGCAAGAGCTGGATGGCCTTGCTGCGCAGGGAGATTGGCCACTTCCACGAAAAGAAAGACCTGCCCTTG
GACACCAGCGACTCCAGCTCGGACACAGACAGCTTCTACGGCGCAGTTGAGCGGCCTGTGGATATCAGCC
TTTCCCCGTACCCCACGGACAATGAAGACTATGAGCACGACGATGAGGATGACTCCTACCTGGAGCCTGA
CTCCCCGGAGCCCGGAAGGCTTGAGGATGCCCTGATGCACCCACCGGCTTACCCACCACCCCCAGTGCCC
ACGCCCAGGAAGCCAGCCTTCTCTGACATGCCCCGGGCCCACTCCTTTACCTCCAAGGGCCCCGGTCCCC
TACTGCCACCCCCGCCCCCTAAGCACGGCCTCCCAGATGTTGGCCTGGCTGCTGAGGACTCCAAGAGGGA
CCCACTGTGCCCGAGGCGGGCTGAGCCTTGCCCCAGGGTACCTGCTACCCCCCGAAGGATGAGCGATCCC
CCTCTGAGCACCATGCCCACCGCACCCGGCCTCCGGAAACCCCCTTGCTTCCGGGAGAGTGCCAGCCCCA
GCCCGGAGCCCTGGACCCCTGGCCACGGGGCCTGCTCCACTTCCAGTGCTGCCATCATGGCCACTGCCAC
CTCCAGAAACTGTGACAAACTCAAGTCCTTCCACCTGTCCCCCCGAGGACCACCCACATCTGAGCCCCCA
CCTGTGCCAGCCAACAAGCCCAAGTTCCTGAAGATAGCTGAAGAGGACCCCCCAAGGGAGGCAGCCATGC
CCGGACTCTTTGTGCCCCCCGTGGCTCCCCGGCCTCCTGCGCTGAAGCTGCCAGTGCCTGAGGCCATGGC
GCGGCCCGCAGTCCTGCCCAGGCCAGAGAAGCCGCAGCTCCCGCACCTCCAGCGATCACCCCCCGATGGG
CAGAGTTTCAGGAGCTTCTCCTTTGAAAAGCCCCGGCAACCCTCACAGGCTGACACTGGCGGGGACGACT
CGGACGAGGACTATGAGAAGGTGCCACTGCCCAACTCGGTCTTCGTCAACACCACGGAGTCCTGCGAAGT
GGAAAGGTTGTTCAAGGCTACAAGCCCCCGGGGAGAGCCCCAGGATGGACTCTACTGCATCCGGAACTCC
TCTACCAAGTCGGGGAAGGTCCTGGTTGTGTGGGACGAAACCTCTAACAAAGTGAGGAACTATCGCATTT
TTGAGAAGGACTCTAAGTTCTACCTGGAGGGCGAGGTCCTGTTTGTGAGTGTGGGCAGCATGGTGGAGCA
CTACCACACCCACGTGCTGCCCAGCCACCAGAGCCTGCTGCTGCGGCACCCCTACGGCTACACTGGGCCT
AGGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001122681
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001122681.1, NP_001116153.1
RefSeq Size 9068 bp
RefSeq ORF 1686 bp
Locus ID 6452
Cytogenetics 4p16.3
Protein Families Druggable Genome
Protein Pathways Natural killer cell mediated cytotoxicity
Gene Summary 'The protein encoded by this gene has an N-terminal pleckstrin homology (PH) domain, an SH3-binding proline-rich region, and a C-terminal SH2 domain. The protein binds to the SH3 domains of several proteins including the ABL1 and SYK protein tyrosine kinases , and functions as a cytoplasmic adaptor protein to positively regulate transcriptional activity in T, natural killer (NK), and basophilic cells. Mutations in this gene result in cherubism. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]'
Transcript Variant: This variant (2) represents use of an alternative promoter and 5' UTR and uses a downstream translation start site, compared to variant 3. The resulting isoform (a) has a shorter N-terminus, compared to isoform b. Variants 1 and 2 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.