RHOC (NM_001042679) Human Untagged Clone

CAT#: SC319336

RHOC (untagged)-Human ras homolog gene family, member C (RHOC), transcript variant 3


  "NM_001042679" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "RHOC"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RHOC
Synonyms ARH9; ARHC; H9; RHOH9
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_001042679.1 CTGGAGGCGGCGGAGCGGAAGCCTTGACTTCATCTCAGCTCCAGAGCCCGCCCTCTCTTC
CTGCAGCCTGGGAACTTCAGCCGGCTGGAGCCCCACCATGGCTGCAATCCGAAAGAAGCT
GGTGATCGTTGGGGATGGTGCCTGTGGGAAGACCTGCCTCCTCATCGTCTTCAGCAAGGA
TCAGTTTCCGGAGGTCTACGTCCCTACTGTCTTTGAGAACTATATTGCGGACATTGAGGT
GGACGGCAAGCAGGTGGAGCTGGCTCTGTGGGACACAGCAGGGCAGGAAGACTATGATCG
ACTGCGGCCTCTCTCCTACCCGGACACTGATGTCATCCTCATGTGCTTCTCCATCGACAG
CCCTGACAGCCTGGAAAACATTCCTGAGAAGTGGACCCCAGAGGTGAAGCACTTCTGCCC
CAACGTGCCCATCATCCTGGTGGGGAATAAGAAGGACCTGAGGCAAGACGAGCACACCAG
GAGAGAGCTGGCCAAGATGAAGCAGGAGCCCGTTCGGTCTGAGGAAGGCCGGGACATGGC
GAACCGGATCAGTGCCTTTGGCTACCTTGAGTGCTCAGCCAAGACCAAGGAGGGAGTGCG
GGAGGTGTTTGAGATGGCCACTCGGGCTGGCCTCCAGGTCCGCAAGAACAAGCGTCGGAG
GGGCTGTCCCATTCTCTGAGATCCCCAAGGCCTTTCCTACATGCCCCCTCCCTTCACAGG
GGTACAGAAATTATCCCCCTACAACCCCAGCCTCCTGAGGGCTCCATGCTGAAGGCTCCC
ATTTTCAGTTCCCTCCTGCCCAGGACTGCATTGTTTTCTAGCCCCGAGGTGGTGGCACGG
GCCCTCCCTCCCAGCGCTCTGGGAGCCACGCCTATGCCCTGCCCTTCCTCAGGGCCCCTG
GGGATCTTGCCCCCTTTGACCTTCCCCAAAGGATGGTCACACACCAGCACTTTATACACT
TCTGGCTCACAGGAAAGTGTCTGCAGTAGGGGACCCAGAGTCCCAGGCCCCTGGAGTTGT
TTTCGGCAGGGGCCTTGTCTCTCACTGCATTTGGTCAGGGGGGCATGAATAAAGGCTACA
GGCTCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001042679
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001042679.1, NP_001036144.1
RefSeq Size 1313 bp
RefSeq ORF 582 bp
Locus ID 389
Cytogenetics 1p13.2
Protein Families Druggable Genome
Gene Summary 'This gene encodes a member of the Rho family of small GTPases, which cycle between inactive GDP-bound and active GTP-bound states and function as molecular switches in signal transduction cascades. Rho proteins promote reorganization of the actin cytoskeleton and regulate cell shape, attachment, and motility. The protein encoded by this gene is prenylated at its C-terminus, and localizes to the cytoplasm and plasma membrane. It is thought to be important in cell locomotion. Overexpression of this gene is associated with tumor cell proliferation and metastasis. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2, and 3 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.