NME2 (NM_001018139) Human Untagged Clone

CAT#: SC319374

NME2 (untagged)-Human non-metastatic cells 2, protein (NM23B) expressed in (NME2), transcript variant 4


  "NM_001018139" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "NME2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NME2
Synonyms NDKB; NDPK-B; NDPKB; NM23-H2; NM23B; PUF
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_001018139.1 GTTCCCTCTTCCGCTTGCGCTGCCGCAGGACCATGGCCAACCTGGAGCGCACCTTCATCG
CCATCAAGCCGGACGGCGTGCAGCGCGGCCTGGTGGGCGAGATCATCAAGCGCTTCGAGC
AGAAGGGATTCCGCCTCGTGGCCATGAAGTTCCTCCGGGCCTCTGAAGAACACCTGAAGC
AGCACTACATTGACCTGAAAGACCGACCATTCTTCCCTGGGCTGGTGAAGTACATGAACT
CAGGGCCGGTTGTGGCCATGGTCTGGGAGGGGCTGAACGTGGTGAAGACAGGCCGAGTGA
TGCTTGGGGAGACCAATCCAGCAGATTCAAAGCCAGGCACCATTCGTGGGGACTTCTGCA
TTCAGGTTGGCAGGAACATCATTCATGGCAGTGATTCAGTAAAAAGTGCTGAAAAAGAAA
TCAGCCTATGGTTTAAGCCTGAAGAACTGGTTGACTACAAGTCTTGTGCTCATGACTGGG
TCTATGAATAAGAGGTGGACACAACAGCAGTCTCCTTCAGCACGGCGTGGTGTGTCCCTG
GACACAGCTCTTCATTCCATTGACTTAGAGGCAACAGGATTGATCATTCTTTTATAGAGC
ATATTTGCCAATAAAGCTTTTGGAAGCCGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001018139
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001018139.1, NP_001018149.1
RefSeq Size 702 bp
RefSeq ORF 459 bp
Locus ID 4831
Cytogenetics 17q21.33
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Metabolic pathways, Purine metabolism, Pyrimidine metabolism
Gene Summary 'Nucleoside diphosphate kinase (NDK) exists as a hexamer composed of 'A' (encoded by NME1) and 'B' (encoded by this gene) isoforms. Multiple alternatively spliced transcript variants have been found for this gene. Read-through transcription from the neighboring upstream gene (NME1) generates naturally-occurring transcripts (NME1-NME2) that encode a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Nov 2010]'
Transcript Variant: This variant (4) differs in the 5' UTR, compared to variant 1. Variants 1-4 encode the same isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.