POLR2E (NM_002695) Human Untagged Clone

CAT#: SC319449

POLR2E (untagged)-Human polymerase (RNA) II (DNA directed) polypeptide E, 25kDa (POLR2E)


  "NM_002695" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "POLR2E"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol POLR2E
Synonyms hRPB25; hsRPB5; RPABC1; RPB5; XAP4
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_002695.2 GGCGGCGGCGGCGGAGGCTGCCATGGACGACGAGGAGGAGACGTACCGGCTCTGGAAAAT
CCGCAAGACCATCATGCAGCTGTGCCACGACCGTGGCTATCTGGTGACCCAGGACGAGCT
TGACCAGACCCTGGAGGAGTTCAAAGCCCAATTTGGGGACAAGCCGAGTGAGGGGCGGCC
GCGGCGCACGGACCTCACCGTGCTGGTGGCCCACAACGATGACCCCACCGACCAGATGTT
TGTGTTCTTTCCAGAGGAGCCCAAGGTGGGCATCAAGACCATCAAGGTGTACTGCCAGCG
CATGCAGGAGGAGAACATCACACGGGCTCTCATCGTGGTGCAGCAGGGCATGACACCCTC
CGCCAAGCAGTCCCTGGTCGACATGGCCCCCAAGTACATCCTGGAGCAGTTTCTGCAGCA
GGAGCTGCTCATCAACATCACGGAGCACGAGCTAGTCCCTGAGCACGTCGTCATGACCAA
GGAGGAGGTGACAGAGCTGCTGGCCCGATATAAGCTCCGAGAGAACCAGCTGCCCAGGAT
CCAGGCGGGGGACCCTGTGGCGCGCTACTTTGGGATAAAGCGTGGGCAGGTGGTGAAGAT
CATCCGGCCCAGTGAGACGGCTGGCAGGTACATCACCTACCGGCTGGTGCAGTAGCTACC
GCCTGACAGCCCCTAGAGGCGGACACACAGCGACCCCCATCCCTGCAGGACAAACGCCCC
TGCCCTGCCAGAATCCGGCCCCCACAGCTCTCACGGCTGCTGCTCCTCTGGACTCCCCAA
GGCAGGTGGCCTCCACCCACGTTCTCCCGTCCTGGGGTGAGGCTTCCTGTGGCCCAGCCC
GCCCCATTCACCTGTGGATTTGTGCGAGATGCAGCCTCAGAAGGAACAAGGCCCCCAGAG
GGAGGTCACCTGGGGGCAGCTGGTGCCGGGTCTTCACCCAGACCACGCTGGGTCCCCTCT
GTTGGGGGTTTGGGGTCCGGGTCTCCCACCAGCCACTGCTTCCTCCTGGGCCCTCGGCCT
TCCACCCCTCGTCTTCCCTCCCTCGGGGGCCCTGATGCGTGGCGGCCCCCACCCGGCCTC
GGCTCTTTACTCCATTCACAGCCGTGCACGCGCTCAAGCCACCAGGGTGCGAGATGCCAG
CTCTGGAGTTCTCGGTTGTTGTAGGAGGTTGGGTGTTTTCAAATGGTAAAGATGTTTTGA
GCAAATAAATTTGCTTGATACAGAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_002695
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002695.2, NP_002686.2
RefSeq Size 1238 bp
RefSeq ORF 633 bp
Locus ID 5434
Cytogenetics 19p13.3
Domains RNA_pol_Rpb5_C, RNA_pol_Rpb5_N
Protein Families Transcription Factors
Protein Pathways Huntington's disease, Metabolic pathways, Purine metabolism, Pyrimidine metabolism, RNA polymerase
Gene Summary 'This gene encodes the fifth largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. This subunit is shared by the other two DNA-directed RNA polymerases and is present in two-fold molar excess over the other polymerase subunits. An interaction between this subunit and a hepatitis virus transactivating protein has been demonstrated, suggesting that interaction between transcriptional activators and the polymerase can occur through this subunit. A pseudogene is located on chromosome 11. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]'
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.