RPS6 (NM_001010) Human Untagged Clone
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RPS6 |
Synonyms | S6 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001010.2
GGGGCTCTTTTCCGTGGCGCCTCGGAGGCGTTCAGCTGCTTCAAGATGAAGCTGAACATC
TCCTTCCCAGCCACTGGCTGCCAGAAACTCATTGAAGTGGACGATGAACGCAAACTTCGT ACTTTCTATGAGAAGCGTATGGCCACAGAAGTTGCTGCTGACGCTCTGGGTGAAGAATGG AAGGGTTATGTGGTCCGAATCAGTGGTGGGAACGACAAACAAGGTTTCCCCATGAAGCAG GGTGTCTTGACCCATGGCCGTGTCCGCCTGCTACTGAGTAAGGGGCATTCCTGTTACAGA CCAAGGAGAACTGGAGAAAGAAAGAGAAAATCAGTTCGTGGTTGCATTGTGGATGCAAAT CTGAGCGTTCTCAACTTGGTTATTGTAAAAAAAGGAGAGAAGGATATTCCTGGACTGACT GATACTACAGTGCCTCGCCGCCTGGGCCCCAAAAGAGCTAGCAGAATCCGCAAACTTTTC AATCTCTCTAAAGAAGATGATGTCCGCCAGTATGTTGTAAGAAAGCCCTTAAATAAAGAA GGTAAGAAACCTAGGACCAAAGCACCCAAGATTCAGCGTCTTGTTACTCCACGTGTCCTG CAGCACAAACGGCGGCGTATTGCTCTGAAGAAGCAGCGTACCAAGAAAAATAAAGAAGAG GCTGCAGAATATGCTAAACTTTTGGCCAAGAGAATGAAGGAGGCTAGGGAGAAGCGCCAG GAACAAATTGCGAAGAGACGCAGACTTTCCTCTCTGCGAGCTTCTACTTCTAAGTCTGAA TCCAGTCAGAAATAAGATTTTTTGAGTAACAAATAAATAAGATCAGACTCCAAAAAAAAA AAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001010 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001010.2, NP_001001.2 |
RefSeq Size | 829 bp |
RefSeq ORF | 750 bp |
Locus ID | 6194 |
Cytogenetics | 9p22.1 |
Domains | Ribosomal_S6e |
Protein Pathways | Insulin signaling pathway, mTOR signaling pathway, Ribosome |
Gene Summary | 'Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a cytoplasmic ribosomal protein that is a component of the 40S subunit. The protein belongs to the S6E family of ribosomal proteins. It is the major substrate of protein kinases in the ribosome, with subsets of five C-terminal serine residues phosphorylated by different protein kinases. Phosphorylation is induced by a wide range of stimuli, including growth factors, tumor-promoting agents, and mitogens. Dephosphorylation occurs at growth arrest. The protein may contribute to the control of cell growth and proliferation through the selective translation of particular classes of mRNA. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]' |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205638 | RPS6 (Myc-DDK-tagged)-Human ribosomal protein S6 (RPS6) |
USD 98.00 |
|
RG205638 | RPS6 (GFP-tagged) - Human ribosomal protein S6 (RPS6) |
USD 460.00 |
|
RC205638L1 | Lenti ORF clone of Human ribosomal protein S6 (RPS6), Myc-DDK-tagged |
USD 768.00 |
|
RC205638L2 | Lenti ORF clone of Human ribosomal protein S6 (RPS6), mGFP tagged |
USD 620.00 |
|
RC205638L3 | Lenti ORF clone of Human ribosomal protein S6 (RPS6), Myc-DDK-tagged |
USD 768.00 |
|
RC205638L4 | Lenti ORF clone of Human ribosomal protein S6 (RPS6), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review