NDUFS4 (NM_002495) Human Untagged Clone

CAT#: SC320828

NDUFS4 (untagged)-Human NADH dehydrogenase (ubiquinone) Fe-S protein 4, 18kDa (NADH-coenzyme Q reductase) (NDUFS4), nuclear gene encoding mitochondrial protein


  "NM_002495" in other vectors (7)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "NDUFS4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NDUFS4
Synonyms AQDQ; CI-18; CI-18 kDa; CI-AQDQ; MC1DN1
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_002495.1 ATCCTGGCGTTTGCCTGCAGCAAGATGGCGGCGGTCTCAATGTCAGTGGTACTGAGGCAG
ACGTTGTGGCGGAGAAGGGCAGTGGCTGTAGCTGCCCTTTCCGTTTCCAGGGTTCCGACC
AGGTCGTTGAGGACTTCCTCATGGAGATTGGCACAGGACCAGACTCAAGACACACAACTC
ATAACAGTTGATGAAAAATTGGATATCACTACTTTAACTGGCGTTCCAGAAGAGCATATA
AAAACTAGAAAAGTCAGGATCTTTGTTCCTGCTCGCAATAACATGCAGTCTGGAGTAAAC
AACACAAAGAAATGGAAGATGGAGTTTGATACCAGGGAGCGATGGGAAAATCCTTTGATG
GGTTGGGCATCAACGGCTGATCCCTTATCCAACATGGTTCTAACCTTCAGTACTAAAGAA
GATGCAGTTTCCTTTGCAGAAAAAAATGGATGGAGCTATGACATTGAAGAGAGGAAGGTT
CCAAAACCCAAGTCCAAGTCTTATGGTGCAAACTTTTCTTGGAACAAAAGAACAAGAGTA
TCCACAAAATAGGTTGGCACTGACTATATCTCTGCTTGACTGTGAATAAAGTCAGCTATG
CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_002495
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002495.1, NP_002486.1
RefSeq Size 668 bp
RefSeq ORF 528 bp
Locus ID 4724
Cytogenetics 5q11.2
Domains ETC_CI_21
Protein Families Druggable Genome
Protein Pathways Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
Gene Summary 'This gene encodes an nuclear-encoded accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (complex I, or NADH:ubiquinone oxidoreductase). Complex I removes electrons from NADH and passes them to the electron acceptor ubiquinone. Mutations in this gene can cause mitochondrial complex I deficiencies such as Leigh syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]'
Transcript Variant: This variant (1) encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.