NDUFS4 (NM_002495) Human Untagged Clone
CAT#: SC320828
NDUFS4 (untagged)-Human NADH dehydrogenase (ubiquinone) Fe-S protein 4, 18kDa (NADH-coenzyme Q reductase) (NDUFS4), nuclear gene encoding mitochondrial protein
"NM_002495" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NDUFS4 |
Synonyms | AQDQ; CI-18; CI-18 kDa; CI-AQDQ; MC1DN1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_002495.1
ATCCTGGCGTTTGCCTGCAGCAAGATGGCGGCGGTCTCAATGTCAGTGGTACTGAGGCAG
ACGTTGTGGCGGAGAAGGGCAGTGGCTGTAGCTGCCCTTTCCGTTTCCAGGGTTCCGACC AGGTCGTTGAGGACTTCCTCATGGAGATTGGCACAGGACCAGACTCAAGACACACAACTC ATAACAGTTGATGAAAAATTGGATATCACTACTTTAACTGGCGTTCCAGAAGAGCATATA AAAACTAGAAAAGTCAGGATCTTTGTTCCTGCTCGCAATAACATGCAGTCTGGAGTAAAC AACACAAAGAAATGGAAGATGGAGTTTGATACCAGGGAGCGATGGGAAAATCCTTTGATG GGTTGGGCATCAACGGCTGATCCCTTATCCAACATGGTTCTAACCTTCAGTACTAAAGAA GATGCAGTTTCCTTTGCAGAAAAAAATGGATGGAGCTATGACATTGAAGAGAGGAAGGTT CCAAAACCCAAGTCCAAGTCTTATGGTGCAAACTTTTCTTGGAACAAAAGAACAAGAGTA TCCACAAAATAGGTTGGCACTGACTATATCTCTGCTTGACTGTGAATAAAGTCAGCTATG CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_002495 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002495.1, NP_002486.1 |
RefSeq Size | 668 bp |
RefSeq ORF | 528 bp |
Locus ID | 4724 |
Cytogenetics | 5q11.2 |
Domains | ETC_CI_21 |
Protein Families | Druggable Genome |
Protein Pathways | Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
Gene Summary | 'This gene encodes an nuclear-encoded accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (complex I, or NADH:ubiquinone oxidoreductase). Complex I removes electrons from NADH and passes them to the electron acceptor ubiquinone. Mutations in this gene can cause mitochondrial complex I deficiencies such as Leigh syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]' Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC118622 | NDUFS4 (untagged)-Human NADH dehydrogenase (ubiquinone) Fe-S protein 4, 18kDa (NADH-coenzyme Q reductase) (NDUFS4), nuclear gene encoding mitochondrial protein |
USD 420.00 |
|
RC202713 | NDUFS4 (Myc-DDK-tagged)-Human NADH dehydrogenase (ubiquinone) Fe-S protein 4, 18kDa (NADH-coenzyme Q reductase) (NDUFS4), nuclear gene encoding mitochondrial protein |
USD 98.00 |
|
RG202713 | NDUFS4 (GFP-tagged) - Human NADH dehydrogenase (ubiquinone) Fe-S protein 4, 18kDa (NADH-coenzyme Q reductase) (NDUFS4), nuclear gene encoding mitochondrial protein |
USD 460.00 |
|
RC202713L1 | Lenti ORF clone of Human NADH dehydrogenase (ubiquinone) Fe-S protein 4, 18kDa (NADH-coenzyme Q reductase) (NDUFS4), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
USD 768.00 |
|
RC202713L2 | Lenti ORF clone of Human NADH dehydrogenase (ubiquinone) Fe-S protein 4, 18kDa (NADH-coenzyme Q reductase) (NDUFS4), nuclear gene encoding mitochondrial protein, mGFP tagged |
USD 620.00 |
|
RC202713L3 | Lenti ORF clone of Human NADH dehydrogenase (ubiquinone) Fe-S protein 4, 18kDa (NADH-coenzyme Q reductase) (NDUFS4), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
USD 620.00 |
|
RC202713L4 | Lenti ORF clone of Human NADH dehydrogenase (ubiquinone) Fe-S protein 4, 18kDa (NADH-coenzyme Q reductase) (NDUFS4), nuclear gene encoding mitochondrial protein, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review