GAMT (NM_000156) Human Untagged Clone
CAT#: SC320844
GAMT (untagged)-Human guanidinoacetate N-methyltransferase (GAMT), transcript variant 1
"NM_000156" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GAMT |
Synonyms | CCDS2; HEL-S-20; PIG2; TP53I2 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_000156.4
GCGGCGCGCGATCGAGGTCGGGTCGCCGTCCAGCCTGCAGCATGAGCGCCCCCAGCGCGA
CCCCCATCTTCGCGCCCGGCGAGAACTGCAGCCCCGCGTGGGGGGCGGCGCCCGCGGCCT ACGACGCAGCGGACACGCACCTGCGCATCCTGGGCAAGCCGGTGATGGAGCGCTGGGAGA CCCCCTATATGCACGCGCTGGCCGCCGCCGCCTCCTCCAAAGGGGGCCGGGTCCTGGAGG TGGGCTTTGGCATGGCCATCGCAGCGTCAAAGGTGCAGGAGGCGCCCATTGATGAGCATT GGATCATCGAGTGCAATGACGGCGTCTTCCAGCGGCTCCGGGACTGGGCCCCACGGCAGA CACACAAGGTCATCCCCTTGAAAGGCCTGTGGGAGGATGTGGCACCCACCCTGCCTGACG GTCACTTTGATGGGATCCTGTACGACACGTACCCACTCTCGGAGGAGACCTGGCACACAC ACCAGTTCAACTTCATCAAGAACCACGCCTTTCGCCTGCTGAAGCCGGGGGGCGTCCTCA CCTACTGCAACCTCACCTCCTGGGGGGAGCTGATGAAGTCCAAGTACTCAGACATCACCA TCATGTTTGAGGAGACGCAGGTGCCCGCGCTGCTGGAGGCCGGCTTCCGGAGGGAGAACA TCCGTACGGAGGTGATGGCGCTGGTCCCACCGGCCGACTGCCGCTACTACGCCTTCCCAC AGATGATCACGCCCCTGGTGACCAAAGGCTGAGCCCCCACCCCGGCCCGGCCACACCCAT GCCCTCCTCCGTGCCTTCCTGGCCGGGAGTCCAGGGTGTCGCACCAGCCCTGGGCTGATC CCAGCTGTGTGTCACCAGAAGCTTTCCCGGCTTCTCTGTGAGGGGTCCCACCAGCCCAGG GCTGATCCCAGCTGTGTGTCACCAGCAGCTTTCCCAGCTTCTCTGTGAGGGTCACTGCTG CCCACTGCAGGGTCCCTGAGGTGAAGTAAACGCCGGCGCTGGGCTTGGCCAGTCGGCAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_000156 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_000156.4, NP_000147.1 |
RefSeq Size | 1086 bp |
RefSeq ORF | 711 bp |
Locus ID | 2593 |
Cytogenetics | 19p13.3 |
Protein Families | Druggable Genome |
Protein Pathways | Arginine and proline metabolism, Glycine, serine and threonine metabolism, Metabolic pathways |
Gene Summary | 'The protein encoded by this gene is a methyltransferase that converts guanidoacetate to creatine, using S-adenosylmethionine as the methyl donor. Defects in this gene have been implicated in neurologic syndromes and muscular hypotonia, probably due to creatine deficiency and accumulation of guanidinoacetate in the brain of affected individuals. Two transcript variants encoding different isoforms have been described for this gene. Pseudogenes of this gene are found on chromosomes 2 and 13. [provided by RefSeq, Feb 2012]' Transcript Variant: This variant (1) is the longer transcript but encodes the shorter isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC120079 | GAMT (untagged)-Human guanidinoacetate N-methyltransferase (GAMT), transcript variant 1 |
USD 310.00 |
|
RC200528 | GAMT (Myc-DDK-tagged)-Human guanidinoacetate N-methyltransferase (GAMT), transcript variant 1 |
USD 420.00 |
|
RG200528 | GAMT (GFP-tagged) - Human guanidinoacetate N-methyltransferase (GAMT), transcript variant 1 |
USD 460.00 |
|
RC200528L1 | Lenti-ORF clone of GAMT (Myc-DDK-tagged)-Human guanidinoacetate N-methyltransferase (GAMT), transcript variant 1 |
USD 768.00 |
|
RC200528L2 | Lenti-ORF clone of GAMT (mGFP-tagged)-Human guanidinoacetate N-methyltransferase (GAMT), transcript variant 1 |
USD 620.00 |
|
RC200528L3 | Lenti-ORF clone of GAMT (Myc-DDK-tagged)-Human guanidinoacetate N-methyltransferase (GAMT), transcript variant 1 |
USD 620.00 |
|
RC200528L4 | Lenti-ORF clone of GAMT (mGFP-tagged)-Human guanidinoacetate N-methyltransferase (GAMT), transcript variant 1 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review