RAD51C (NM_058216) Human Untagged Clone
CAT#: SC321013
RAD51C (untagged)-Human RAD51 homolog C (S. cerevisiae) (RAD51C), transcript variant 1
"NM_058216" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RAD51C |
Synonyms | BROVCA3; FANCO; R51H3; RAD51L2 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_058216.1
GGGGGACGTCACGCCGCACGCCCCAGCGAGGGCGTGCGGAGTTTGGCTGCTCCGGGGTTA
GCAGGTGAGCCTGCGATGCGCGGGAAGACGTTCCGCTTTGAAATGCAGCGGGATTTGGTG AGTTTCCCGCTGTCTCCAGCGGTGCGGGTGAAGCTGGTGTCTGCGGGGTTCCAGACTGCT GAGGAACTCCTAGAGGTGAAACCCTCCGAGCTTAGCAAAGAAGTTGGGATATCTAAAGCA GAAGCCTTAGAAACTCTGCAAATTATCAGAAGAGAATGTCTCACAAATAAACCAAGATAT GCTGGTACATCTGAGTCACACAAGAAGTGTACAGCACTGGAACTTCTTGAGCAGGAGCAT ACCCAGGGCTTCATAATCACCTTCTGTTCAGCACTAGATGATATTCTTGGGGGTGGAGTG CCCTTAATGAAAACAACAGAAATTTGTGGTGCACCAGGTGTTGGAAAAACACAATTATGT ATGCAGTTGGCAGTAGATGTGCAGATACCAGAATGTTTTGGAGGAGTGGCAGGTGAAGCA GTTTTTATTGATACAGAGGGAAGTTTTATGGTTGATAGAGTGGTAGACCTTGCTACTGCC TGCATTCAGCACCTTCAGCTTATAGCAGAAAAACACAAGGGAGAGGAACACCGAAAAGCT TTGGAGGATTTCACTCTTGATAATATTCTTTCTCATATTTATTATTTTCGCTGTCGTGAC TACACAGAGTTACTGGCACAAGTTTATCTTCTTCCAGATTTCCTTTCAGAACACTCAAAG GTTCGACTAGTGATAGTGGATGGTATTGCTTTTCCATTTCGTCATGACCTAGATGACCTG TCTCTTCGTACTCGGTTATTAAATGGCCTAGCCCAGCAAATGATCAGCCTTGCAAATAAT CACAGATTAGCTGTAATTTTAACCAATCAGATGACAACAAAGATTGATAGAAATCAGGCC TTGCTTGTTCCTGCATTAGGGGAAAGTTGGGGACATGCTGCTACAATACGGCTAATCTTT CATTGGGACCGAAAGCAAAGGTTGGCAACATTGTACAAGTCACCCAGCCAGAAGGAATGC ACAGTACTGTTTCAAATCAAACCTCAGGGATTTAGAGATACTGTTGTTACTTCTGCATGT TCATTGCAAACAGAAGGTTCCTTGAGCACCCGGAAACGGTCACGAGACCCAGAGGAAGAA TTATAACCCAGAAACAAATCTCAAAGTGTACAAATTTATTGATGTTGTGAAATCAATGTG TACAAGTGGACTTGTTACCTTAAAGTATAAATAAACACACTATGGCACGAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_058216 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_058216.1, NP_478123.1 |
RefSeq Size | 1295 bp |
RefSeq ORF | 1131 bp |
Locus ID | 5889 |
Cytogenetics | 17q22 |
Protein Families | Druggable Genome |
Protein Pathways | Homologous recombination |
Gene Summary | 'This gene is a member of the RAD51 family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51 and are known to be involved in the homologous recombination and repair of DNA. This protein can interact with other RAD51 paralogs and is reported to be important for Holliday junction resolution. Mutations in this gene are associated with Fanconi anemia-like syndrome. This gene is one of four localized to a region of chromosome 17q23 where amplification occurs frequently in breast tumors. Overexpression of the four genes during amplification has been observed and suggests a possible role in tumor progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]' Transcript Variant: This variant (1) is the longest transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC109703 | RAD51C (untagged)-Human RAD51 homolog C (S. cerevisiae) (RAD51C), transcript variant 1 |
USD 760.00 |
|
RC210462 | RAD51C (Myc-DDK-tagged)-Human RAD51 homolog C (S. cerevisiae) (RAD51C), transcript variant 1 |
USD 420.00 |
|
RG210462 | RAD51C (GFP-tagged) - Human RAD51 homolog C (S. cerevisiae) (RAD51C), transcript variant 1 |
USD 460.00 |
|
RC210462L1 | Lenti ORF clone of Human RAD51 homolog C (S. cerevisiae) (RAD51C), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC210462L2 | Lenti ORF clone of Human RAD51 homolog C (S. cerevisiae) (RAD51C), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC210462L3 | Lenti ORF clone of Human RAD51 homolog C (S. cerevisiae) (RAD51C), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC210462L4 | Lenti ORF clone of Human RAD51 homolog C (S. cerevisiae) (RAD51C), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review