Glutathione S Transferase alpha 1 (GSTA1) (NM_145740) Human Untagged Clone

CAT#: SC321900

GSTA1 (untagged)-Human glutathione S-transferase alpha 1 (GSTA1)


  "NM_145740" in other vectors (4)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "GSTA1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GSTA1
Synonyms GST-epsilon; GST2; GSTA1-1; GTH1
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_145740.2 GTGACAGCGTTTAACAAAGCTTAGAGAAACCTCCAGGAGACTGCTATCATGGCAGAGAAG
CCCAAGCTCCACTACTTCAATGCACGGGGCAGAATGGAGTCCACCCGGTGGCTCCTGGCT
GCAGCTGGAGTAGAGTTTGAAGAGAAATTTATAAAATCTGCAGAAGATTTGGACAAGTTA
AGAAATGATGGATATTTGATGTTCCAGCAAGTGCCAATGGTTGAGATTGATGGGATGAAG
CTGGTGCAGACCAGAGCCATTCTCAACTACATTGCCAGCAAATACAACCTCTATGGGAAA
GACATAAAGGAGAGAGCCCTGATTGATATGTATATAGAAGGTATAGCAGATTTGGGTGAA
ATGATCCTCCTTCTGCCCGTATGTCCACCTGAGGAAAAAGATGCCAAGCTTGCCTTGATC
AAAGAGAAAATAAAAAATCGCTACTTCCCTGCCTTTGAAAAAGTCTTAAAGAGCCATGGA
CAAGACTACCTTGTTGGCAACAAGCTGAGCCGGGCTGACATTCATCTGGTGGAACTTCTC
TACTACGTCGAGGAGCTTGACTCCAGTCTTATCTCCAGCTTCCCTCTGCTGAAGGCCCTG
AAAACCAGAATCAGCAACCTGCCCACAGTGAAGAAGTTTCTACAGCCTGGCAGCCCAAGG
AAGCCTCCCATGGATGAGAAATCTTTAGAAGAAGCAAGGAAGATTTTCAGGTTTTAATAA
CGCAGTCATGGAGGCCAAGAACTTGCAATACCAATGTTCTAAAGTTTTGCAACAATAAAG
TACTTTACCTAAGTGTTGATTGTGCCTGTTGTGAAGCTAATGAACTCTTTCAAATTATAT
GCTAATTAAATAATACAACTCCTATTCGCTGACTTAGTTAAAATTGATTTGTTTTCATTA
GGATCTGATGTGAATTCAGATTTCCAATCTTCTCCTAGCCAACCATTTTCCTGGAATTAA
AAATTCAGTAAAAAAGGAAACTATAGATTATGTGGTTTGTTTGACTTTTCCAAGAATTGT
CCCGTAACATACAATGTGTCATACAATCTATTAAAATGTCAATGTAGAAATGCACTTCTG
ACATTTTCAGGTATGCACAGGAGAAGAGTTACCATCCTGGATAATGGCATAAAGACATTT
TCTTCTTTTAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_145740
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_145740.2, NP_665683.1
RefSeq Size 1046 bp
RefSeq ORF 669 bp
Locus ID 2938
Cytogenetics 6p12.2
Domains GST_N, GST_C
Protein Families Druggable Genome
Protein Pathways Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolism of xenobiotics by cytochrome P450
Gene Summary 'This gene encodes a member of a family of enzymes that function to add glutathione to target electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins, and products of oxidative stress. This action is an important step in detoxification of these compounds. This subfamily of enzymes has a particular role in protecting cells from reactive oxygen species and the products of peroxidation. Polymorphisms in this gene influence the ability of individuals to metabolize different drugs. This gene is located in a cluster of similar genes and pseudogenes on chromosome 6. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]'
Transcript Variant: This variant (1) represents the longer transcript and encode the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.