LUZP6 (NM_001128619) Human Untagged Clone

CAT#: SC322792

LUZP6 (untagged)-Human leucine zipper protein 6 (LUZP6)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LUZP6
• Synonyms: MPD6; MTPNUT
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001128619, the custom clone sequence may differ by one or more nucleotides
  
  
  ATTAAATCAGTCATTTCATATGCACTATATCAAGTACAAACAGGTAGTTTACCTGTTTATAGTAGTGTAC
  TAACAAAGTCTCCCTTGCAGCTTCAGACTGTTATCTATAGGCTTATCGTTCAAATACAGCACTTGAATAT
  CCCAAGTAGTTCTTCTACGCATAGCTCACCTTTCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001128619
• ORF Size: 177 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001128619.2, NP_001122091.2
• RefSeq Size: 3888
• RefSeq ORF: 177
• Locus ID: 767558
• Gene Summary: A bi-cistronic transcript encodes the products of both the myotrophin and leucine zipper protein 6 genes, which are located on chromosome 7. A cryptic ORF at the 3' end of the myotrophin transcript uses a novel internal ribosome entry site and a non-AUG translation initiation codon to produce leucine zipper protein 6, a 6.4 kDa tumor antigen that is associated with myeloproliferative disease. [provided by RefSeq, Jul 2008]