Prokineticin 2 (PROK2) (NM_001126128) Human Untagged Clone
CAT#: SC322834
PROK2 (untagged)-Human prokineticin 2 (PROK2), transcript variant 1
"NM_001126128" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PROK2 |
Synonyms | BV8; HH4; KAL4; MIT1; PK2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001126128, the custom clone sequence may differ by one or more nucleotides
ATGAGGAGCCTGTGCTGCGCCCCACTCCTGCTCCTCTTGCTGCTGCCGCCGCTGCTGCTCACGCCCCGCG CTGGGGACGCCGCCGTGATCACCGGGGCTTGTGACAAGGACTCCCAATGTGGTGGAGGCATGTGCTGTGC TGTCAGTATCTGGGTCAAGAGCATAAGGATTTGCACACCTATGGGCAAACTGGGAGACAGCTGCCATCCA CTGACTCGTAAAAACAATTTTGGAAATGGAAGGCAGGAAAGAAGAAAGAGGAAGAGAAGCAAAAGGAAAA AGGAGGTTCCATTTTTTGGGCGGAGGATGCATCACACTTGCCCATGTCTGCCAGGCTTGGCCTGTTTACG GACTTCATTTAACCGATTTATTTGTTTAGCCCAAAAGTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_001126128 |
ORF Size | 390 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001126128.1, NP_001119600.1 |
RefSeq Size | 1613 |
RefSeq ORF | 390 |
Locus ID | 60675 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | This gene encodes a protein expressed in the suprachiasmatic nucleus (SCN) circadian clock that may function as the output component of the circadian clock. The secreted form of the encoded protein may also serve as a chemoattractant for neuronal precursor cells in the olfactory bulb. Proteins from other vertebrates which are similar to this gene product were isolated based on homology to snake venom and secretions from frog skin, and have been shown to have diverse functions. Mutations in this gene are associated with Kallmann syndrome 4. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) encodes the longer isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225090 | PROK2 (Myc-DDK-tagged)-Human prokineticin 2 (PROK2), transcript variant 1 |
USD 420.00 |
|
RG225090 | PROK2 (GFP-tagged) - Human prokineticin 2 (PROK2), transcript variant 1 |
USD 460.00 |
|
RC225090L3 | Lenti-ORF clone of PROK2 (Myc-DDK-tagged)-Human prokineticin 2 (PROK2), transcript variant 1 |
USD 620.00 |
|
RC225090L4 | Lenti-ORF clone of PROK2 (mGFP-tagged)-Human prokineticin 2 (PROK2), transcript variant 1 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review