Bcl2 Binding component 3 (BBC3) (NM_001127241) Human Untagged Clone
CAT#: SC322840
BBC3 (untagged)-Human BCL2 binding component 3 (BBC3), transcript variant 2
"NM_001127241" in other vectors (4)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | BBC3 |
| Synonyms | JFY-1; JFY1; PUMA |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_001127241 edited
ATGAAATTTGGCATGGGGTCTGCCCAGGCATGTCCATGCCAGGTGCCCAGGGCTGCTTCC ACGACGTGGGTCCCCTGCCAGATTTGTGGTCCTCAGCCCTCGCTCTCGCTGGCGGAGCAG CACCTGGAGTCGCCCGTGCCCAGCGCCCCGGGGGCTCTGGCGGGCGGTCCCACCCAGGCG GCCCCGGGAGTCCGCGGGGAGGAGGAACAGTGGGCCCGGGAGATCGGGGCCCAGCTGCGG CGGATGGCGGACGACCTCAACGCACAGTACGAGCGGCGGAGACAAGAGGAGCAGCAGCGG CACCGCCCCTCACCCTGGAGGGTCCTGTACAATCTCATCATGGGACTCCTGCCCTTACCC AGGGGCCACAGAGCCCCCGAGATGGAGCCCAATTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_001127241 |
| ORF Size | 396 bp |
| Insert Size | 1550 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001127241.1. |
| Reference Data | |
| RefSeq | NM_001127241.1, NP_001120713.1 |
| RefSeq Size | 1550 |
| RefSeq ORF | 396 |
| Locus ID | 27113 |
| Protein Families | Druggable Genome |
| Protein Pathways | Huntington's disease, p53 signaling pathway |
| Gene Summary | This gene encodes a member of the BCL-2 family of proteins. This family member belongs to the BH3-only pro-apoptotic subclass. The protein cooperates with direct activator proteins to induce mitochondrial outer membrane permeabilization and apoptosis. It can bind to anti-apoptotic Bcl-2 family members to induce mitochondrial dysfunction and caspase activation. Because of its pro-apoptotic role, this gene is a potential drug target for cancer therapy and for tissue injury. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (2) encodes isoform 2 (also known as PUMA-beta), which includes the C-terminal BH3 domain and can localize to the mitochondria. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225093 | BBC3 (Myc-DDK-tagged)-Human BCL2 binding component 3 (BBC3), transcript variant 2 |
USD 420.00 |
|
| RG225093 | BBC3 (GFP-tagged) - Human BCL2 binding component 3 (BBC3), transcript variant 2 |
USD 460.00 |
|
| RC225093L3 | Lenti-ORF clone of BBC3 (Myc-DDK-tagged)-Human BCL2 binding component 3 (BBC3), transcript variant 2 |
USD 620.00 |
|
| RC225093L4 | Lenti-ORF clone of BBC3 (mGFP-tagged)-Human BCL2 binding component 3 (BBC3), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China