Bcl2 Binding component 3 (BBC3) (NM_001127241) Human Untagged Clone

CAT#: SC322840

BBC3 (untagged)-Human BCL2 binding component 3 (BBC3), transcript variant 2


  "NM_001127241" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "BBC3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BBC3
Synonyms JFY-1; JFY1; PUMA
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001127241 edited
ATGAAATTTGGCATGGGGTCTGCCCAGGCATGTCCATGCCAGGTGCCCAGGGCTGCTTCC
ACGACGTGGGTCCCCTGCCAGATTTGTGGTCCTCAGCCCTCGCTCTCGCTGGCGGAGCAG
CACCTGGAGTCGCCCGTGCCCAGCGCCCCGGGGGCTCTGGCGGGCGGTCCCACCCAGGCG
GCCCCGGGAGTCCGCGGGGAGGAGGAACAGTGGGCCCGGGAGATCGGGGCCCAGCTGCGG
CGGATGGCGGACGACCTCAACGCACAGTACGAGCGGCGGAGACAAGAGGAGCAGCAGCGG
CACCGCCCCTCACCCTGGAGGGTCCTGTACAATCTCATCATGGGACTCCTGCCCTTACCC
AGGGGCCACAGAGCCCCCGAGATGGAGCCCAATTAG
Restriction Sites Please inquire     
ACCN NM_001127241
ORF Size 396 bp
Insert Size 1550
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001127241.1.
Reference Data
RefSeq NM_001127241.1, NP_001120713.1
RefSeq Size 1550
RefSeq ORF 396
Locus ID 27113
Protein Families Druggable Genome
Protein Pathways Huntington's disease, p53 signaling pathway
Gene Summary This gene encodes a member of the BCL-2 family of proteins. This family member belongs to the BH3-only pro-apoptotic subclass. The protein cooperates with direct activator proteins to induce mitochondrial outer membrane permeabilization and apoptosis. It can bind to anti-apoptotic Bcl-2 family members to induce mitochondrial dysfunction and caspase activation. Because of its pro-apoptotic role, this gene is a potential drug target for cancer therapy and for tissue injury. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (2) encodes isoform 2 (also known as PUMA-beta), which includes the C-terminal BH3 domain and can localize to the mitochondria.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.