HRASLS3 (PLA2G16) (NM_001128203) Human Untagged Clone

CAT#: SC322857

PLA2G16 (untagged)-Human phospholipase A2, group XVI (PLA2G16), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PLA2G16
• Synonyms: AdPLA; H-REV107; H-REV107-1; HRASLS3; HREV107; HREV107-1; HREV107-3; HRSL3; PLA2G16; PLAAT-3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001128203, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCGTGCGCCCATTCCAGAGCCTAAGCCTGGAGACCTGATTGAGATTTTTCGCCCTTTCTACAGACACT
  GGGCCATCTATGTTGGCGATGGATATGTGGTTCATCTGGCCCCTCCAAGTGAGGTCGCAGGAGCTGGTGC
  AGCCAGTGTCATGTCCGCCCTGACTGACAAGGCCATCGTGAAGAAGGAATTGCTGTATGATGTGGCCGGG
  AGTGACAAGTACCAGGTCAACAACAAACATGATGACAAGTACTCGCCGCTGCCCTGCAGCAAAATCATCC
  AGCGGGCGGAGGAGCTGGTGGGGCAGGAGGTGCTCTACAAGCTGACCAGTGAGAACTGCGAGCACTTTGT
  GAATGAGCTGCGCTATGGAGTCGCCCGCAGTGACCAGGTCAGAGATGTCATCATCGCTGCAAGCGTTGCA
  GGAATGGGCTTGGCAGCCATGAGCCTTATTGGAGTCATGTTCTCAAGAAACAAGCGACAAAAGCAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001128203
• ORF Size: 489 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001128203.1, NP_001121675.1
• RefSeq Size: 1111
• RefSeq ORF: 489
• Locus ID: 11145
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: Lipid-modifying enzyme that acts as major regulator of adipocyte lipolysis by catalyzing the release of fatty acids from phospholipids in adipose tissue (PubMed:19615464, PubMed:19047760, PubMed:20837014, PubMed:22605381, PubMed:22923616). Shows phospholipase A1 and A2 activity, catalyzing the calcium-independent hydrolysis of acyl groups in various phosphatidylcholines (PC) and phosphatidylethanolamine (PE) (PubMed:19615464, PubMed:19047760, PubMed:20837014, PubMed:22605381, PubMed:22923616). For most substrates, phospholipase A1 activity is much higher than phospholipase A2 activity (PubMed:19047760). Phospholipase activity causes decreased intracellular levels of ether-type lipids, affecting peroxisome metabolism (By similarity). May also have acyltransferase activity: catalyzes both N-acylation of phosphatidylethanolamine to form N-acyl-phosphatidylethanolamine and O-acylation of lyso-phosphatidylcholines to form phosphatidylcholines (PubMed:22605381, PubMed:25383759). The relevance of acyltransferase activity in vivo is however unclear and would require additional evidences (PubMed:22605381, PubMed:25383759). Also has weak lysophospholipase activity. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform.