CNBP (NM_001127193) Human Untagged Clone
CAT#: SC322870
CNBP (untagged)-Human CCHC-type zinc finger, nucleic acid binding protein (CNBP), transcript variant 2
"NM_001127193" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CNBP |
Synonyms | CNBP1; DM2; PROMM; RNF163; ZCCHC22; ZNF9 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001127193, the custom clone sequence may differ by one or more nucleotides
ATGAGCAGCAATGAGTGCTTCAAGTGTGGACGATCTGGCCACTGGGCCCGGGAATGTCCT ACTGGTGGAGGCCGTGGTCGTGGAATGAGAAGCCGTGGCAGAGGTGGTTTTACCTCGGAT AGAGGTTTCCAGTTTGTTTCCTCGTCTCTTCCAGACATTTGTTATCGCTGTGGTGAGTCT GGTCATCTTGCCAAGGATTGTGATCTTCAGGAGGATGAAGCCTGCTATAACTGCGGTAGA GGTGGCCACATTGCCAAGGACTGCAAGGAGCCCAAGAGAGAGCGAGAGCAATGCTGCTAC AACTGTGGCAAACCAGGCCATCTGGCTCGTGACTGCGACCATGCAGATGAGCAGAAATGC TATTCTTGTGGAGAATTCGGACACATTCAAAAAGACTGCACCAAAGTGAAGTGCTATAGG TGTGGTGAAACTGGTCATGTAGCCATCAACTGCAGCAAGACAAGTGAAGTCAACTGTTAC CGCTGTGGCGAGTCAGGGCACCTTGCACGGGAATGCACAATTGAGGCTACAGCC |
Restriction Sites | Please inquire |
ACCN | NM_001127193 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001127193.1, NP_001120665.1 |
RefSeq Size | 3396 bp |
RefSeq ORF | 537 bp |
Locus ID | 7555 |
Cytogenetics | 3q21.3 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | 'This gene encodes a nucleic-acid binding protein with seven zinc-finger domains. The protein has a preference for binding single stranded DNA and RNA. The protein functions in cap-independent translation of ornithine decarboxylase mRNA, and may also function in sterol-mediated transcriptional regulation. A CCTG expansion from <30 repeats to 75-11000 repeats in the first intron of this gene results in myotonic dystrophy type 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2016]' Transcript Variant: This variant, also known as alpha variant 1, uses an alternate in-frame splice site in the central coding region, compared to variant 1, resulting in a shorter protein (isoform 2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225188 | CNBP (Myc-DDK-tagged)-Human CCHC-type zinc finger, nucleic acid binding protein (CNBP), transcript variant 2 |
USD 420.00 |
|
RG225188 | CNBP (GFP-tagged) - Human CCHC-type zinc finger, nucleic acid binding protein (CNBP), transcript variant 2 |
USD 460.00 |
|
RC225188L3 | Lenti-ORF clone of CNBP (Myc-DDK-tagged)-Human CCHC-type zinc finger, nucleic acid binding protein (CNBP), transcript variant 2 |
USD 620.00 |
|
RC225188L4 | Lenti-ORF clone of CNBP (mGFP-tagged)-Human CCHC-type zinc finger, nucleic acid binding protein (CNBP), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review