PHR1 (PLEKHB1) (NM_001130036) Human Untagged Clone

CAT#: SC322878

PLEKHB1 (untagged)-Human pleckstrin homology domain containing, family B (evectins) member 1 (PLEKHB1), transcript variant 5


  "NM_001130036" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PLEKHB1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PLEKHB1
Synonyms KPL1; PHR1; PHRET1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001130036, the custom clone sequence may differ by one or more nucleotides
ATGGCCCTGGTGAGGGGCGGCTGGCTGTGGAGACAGAGCTCCATCCTCCGCCGCTGGAAG
CGGAACTGGTTTGCCCTGTGGCTGGACGGGACCCTGGGATACTACCACGATGAGACAGCG
CAGGACGAGGAGGACCGTGTGCTCATCCACTTCAATGTCCGTGACATAAAGATCGGCCCA
GAGTGCCATGATGTGCAGCCCCCAGAGGGCCGGAGCCGAGATGGCCTGCTGACTGTGAAC
CTACGGGAAGGCGGCCGCCTGCACCTCTGTGCGGAGACCAAGGATGATGCCCTAGCATGG
AAGACAGCACTGCTGGAGGCAAACTCCACCCCGGTGCGCGTCTACAGCCCGTACCAAGAC
TACTACGAGGTGGTGCCCCCCAATGCACACGAGGCCACGTATGTCCGCAGCTACTACGGA
CCGCCCTACGCAGGCCCTGGCGTGACGCACGTGATAGTGCGGGAGGATCCCTGCTACAGC
GCCGGCGCCCCTCTGGCCATGGGCATGCTTGCGGGAGCCGCCACTGGGGCGGCGCTGGGC
TCGCTCATGTGGTCGCCCTGCTGGTTC
Restriction Sites Please inquire     
ACCN NM_001130036
ORF Size 570 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001130036.1, NP_001123508.1
RefSeq Size 2159
RefSeq ORF 570
Locus ID 58473

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.