ASPA (NM_001128085) Human Untagged Clone

CAT#: SC322967

ASPA (untagged)-Human aspartoacylase (ASPA), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ASPA
• Synonyms: ACY2; ASP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001128085, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACTTCTTGTCACATTGCTGAAGAACATATACAAAAGGTTGCTATCTTTGGAGGAACCCATGGGAATG
  AGCTAACCGGAGTATTTCTGGTTAAGCATTGGCTAGAGAATGGCGCTGAGATTCAGAGAACAGGGCTGGA
  GGTAAAACCATTTATTACTAACCCCAGAGCAGTGAAGAAGTGTACCAGATATATTGACTGTGACCTGAAT
  CGCATTTTTGACCTTGAAAATCTTGGCAAAAAAATGTCAGAAGATTTGCCATATGAAGTGAGAAGGGCTC
  AAGAAATAAATCATTTATTTGGTCCAAAAGACAGTGAAGATTCCTATGACATTATTTTTGACCTTCACAA
  CACCACCTCTAACATGGGGTGCACTCTTATTCTTGAGGATTCCAGGAATAACTTTTTAATTCAGATGTTT
  CATTACATTAAGACTTCTCTGGCTCCACTACCCTGCTACGTTTATCTGATTGAGCATCCTTCCCTCAAAT
  ATGCGACCACTCGTTCCATAGCCAAGTATCCTGTGGGTATAGAAGTTGGTCCTCAGCCTCAAGGGGTTCT
  GAGAGCTGATATCTTGGATCAAATGAGAAAAATGATTAAACATGCTCTTGATTTTATACATCATTTCAAT
  GAAGGAAAAGAATTTCCTCCCTGCGCCATTGAGGTCTATAAAATTATAGAGAAAGTTGATTACCCCCGGG
  ATGAAAATGGAGAAATTGCTGCTATCATCCATCCTAATCTGCAGGATCAAGACTGGAAACCACTGCATCC
  TGGGGATCCCATGTTTTTAACTCTTGATGGGAAGACGATCCCACTGGGCGGAGACTGTACCGTGTACCCC
  GTGTTTGTGAATGAGGCCGCATATTACGAAAAGAAAGAAGCTTTTGCAAAGACAACTAAACTAACGCTCA
  ATGCAAAAAGTATTCGCTGCTGTTTACATTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001128085
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001128085.1, NP_001121557.1
• RefSeq Size: 1368 bp
• RefSeq ORF: 942 bp
• Locus ID: 443
• Cytogenetics: 17p13.2
• Protein Families: Druggable Genome
• Protein Pathways: Alanine, aspartate and glutamate metabolism, Histidine metabolism
• Gene Summary: 'This gene encodes an enzyme that catalyzes the conversion of N-acetyl_L-aspartic acid (NAA) to aspartate and acetate. NAA is abundant in the brain where hydrolysis by aspartoacylase is thought to help maintain white matter. This protein is an NAA scavenger in other tissues. Mutations in this gene cause Canavan disease. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) has an alternate 5' UTR and encodes the same protein, as compared to variant 1.