GTF2H2 (NM_001515) Human Untagged Clone
CAT#: SC324047
GTF2H2 (untagged)-Human general transcription factor IIH, polypeptide 2, 44kDa (GTF2H2)
"NM_001515" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GTF2H2 |
Synonyms | BTF2; BTF2P44; p44; T-BTF2P44; TFIIH |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001515.3
GGCGCAGAGGTGGGGCAGGCCGTCTGACTAGCTAGGCGGCTGGGAGCGTTTTCGTGGCGG
GGAACGGAGGTTGAATTGCCCTGCCTGGGCTCATAGGGAAGGAGGATGTGAAGGAGCTTG TGAAGGCAGAGGAAGATTATTGAATAATAAAATACAGTTTTGAAAAAAATGGATGAAGAA CCTGAAAGAACTAAGCGATGGGAAGGAGGCTATGAAAGAACATGGGAGATTCTTAAAGAA GATGAATCTGGATCACTTAAAGCTACAATAGAAGACATTCTATTCAAGGCAAAGAGAAAA AGAGTATTTGAGCACCATGGACAAGTTCGACTTGGAATGATGCGCCACCTTTATGTGGTA GTAGATGGATCAAGAACAATGGAAGACCAAGATTTAAAGCCTAATAGACTGACGTGTACT TTAAAGTTGTTGGAATACTTTGTAGAGGAATATTTTGATCAAAATCCTATTAGTCAGATT GGAATAATTGTAACTAAGAGTAAAAGAGCTGAAAAATTGACTGAACTTTCAGGAAACCCA AGAAAACATATAACGTCTTTGAAGGAAGCTGTGGATATGACCTGCCATGGAGAGCCATCT CTTTATAATTCCCTAAGCATGGCTATGCAGACTCTAAAACACATGCCTGGACATACAAGT CGAGAAGTACTAATCATCTTTAGCAGCCTTACAACTTGCGATCCATCTAATATTTATGAT TTAATCAAGACCCTAAAGGCAGCTAAAATTAGAGTATCTGTTATTGGATTGTCTGCAGAA GTTCGCGTTTGCACTGTACTTGCTCGTGAAACTGGTGGCACGTACCATGTTATTTTAGAT GAAAGCCATTACAAAGAGTTGCTCACACATCATCTTAGTCCTCCTCCTGCTAGCTCAAGT TCTGAATGCTCACTTATTCGTATGGGATTTCCTCAGCACACCATTGCTTCTTTATCTGAC CAGGATGCAAAACCCTCTTTCAGCATGGCGCATTTGGATGGCAATACTGAGCCAGGGCTT ACATTAGGAGGCTATTTCTGCCCACAGTGTCGGGCAAAGTACTGTGAGCTACCTGTTGAA TGTAAAATCTGTGGTCTTACTTTGGTGTCTGCTCCCCACTTGGCACGGTCTTACCATCAT TTGTTTCCTTTGGATGCTTTTCAAGAAATTCCCCTAGAAGAATATAATGGAGAAAGATTT TGTTATGGATGTCAGGGGGAATTGAAAGACCAACATGTTTATGTTTGTGCTGTGTGCCAA AATGTTTTCTGTGTGGACTGTGATGTTTTTGTTCATGATTCTCTACACTGTTGCCCTGGC TGTATTCATAAGATTCCAGCTCCTTCAGGTGTTTGATTCCAGCATGTAGTATACATTGTA TGTGTTAAAAAGAAATTTGCAACTGTGAATAAAAGGACTTCTTTAGAAGAAGCTTCATTT AAAACATGAAAGGATAATCTGACTTAAGAAACTTTTTGCTAAGAAAAGGTAATATTTTAT TAAATTTTAAATTTGTGTTGTCACAGAAATACCTGAAATTCAGTAGTACTTCATTCAATT AATTTTGTTTTCTATTATTTTGAGTTATACTGTTTTCAAAGTCATTATGCAGTATGTATA AACTTATAAGAATTAAATTGATGTGATAATTTTATGTTTTTATAATTAAATATAGAATCT TTATGAAAAAAAAAAAAAAA |
Restriction Sites | ECoRI-NOT |
ACCN | NM_001515 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001515.3, NP_001506.1 |
RefSeq Size | 1951 bp |
RefSeq ORF | 1188 bp |
Locus ID | 2966 |
Cytogenetics | 5q13.2 |
Domains | VWA, Ssl1 |
Protein Families | Druggable Genome, Stem cell - Pluripotency, Transcription Factors |
Protein Pathways | Basal transcription factors, Nucleotide excision repair |
Gene Summary | 'This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. This gene is within the telomeric copy of the duplication. Deletion of this gene sometimes accompanies deletion of the neighboring SMN1 gene in spinal muscular atrophy (SMA) patients but it is unclear if deletion of this gene contributes to the SMA phenotype. This gene encodes the 44 kDa subunit of RNA polymerase II transcription initiation factor IIH which is involved in basal transcription and nucleotide excision repair. Transcript variants for this gene have been described, but their full length nature has not been determined. A second copy of this gene within the centromeric copy of the duplication has been described in the literature. It is reported to be different by either two or four base pairs; however, no sequence data is currently available for the centromeric copy of the gene. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (1) encodes the longest isoform (a). Variants 1 and 2 both encode the same isoform (a). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
SC310443 | GTF2H2 (untagged)-Human general transcription factor IIH, polypeptide 2, 44kDa (GTF2H2) |
USD 760.00 |
|
RC209543 | GTF2H2 (Myc-DDK-tagged)-Human general transcription factor IIH, polypeptide 2, 44kDa (GTF2H2) |
USD 420.00 |
|
RG209543 | GTF2H2 (GFP-tagged) - Human general transcription factor IIH, polypeptide 2, 44kDa (GTF2H2) |
USD 460.00 |
|
RC209543L1 | Lenti ORF clone of Human general transcription factor IIH, polypeptide 2, 44kDa (GTF2H2), Myc-DDK-tagged |
USD 768.00 |
|
RC209543L2 | Lenti ORF clone of Human general transcription factor IIH, polypeptide 2, 44kDa (GTF2H2), mGFP tagged |
USD 620.00 |
|
RC209543L3 | Lenti ORF clone of Human general transcription factor IIH, polypeptide 2, 44kDa (GTF2H2), Myc-DDK-tagged |
USD 620.00 |
|
RC209543L4 | Lenti ORF clone of Human general transcription factor IIH, polypeptide 2, 44kDa (GTF2H2), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review