MAX (NM_145114) Human Untagged Clone
CAT#: SC324151
MAX (untagged)-Human MYC associated factor X (MAX), transcript variant 4
"NM_145114" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MAX |
Synonyms | bHLHd4 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_145114.1
GGTGGTTCTTGCCCGTGTTGTGTGTGTGTGTGAGTGAGAGAGCGAGTGAGTGAGTGAGTG
AGTGTGTGTGTGGGGGGGACTCGGCTTGTTGTTGTCGGTGACTTCCCCCTCCCCTTCACC CCTTCCCCTCCCCGCCGCCGCTGCAGTGGCCGCTCCCTGGGCCGTAGGAAATGAGCGATA ACGATGACATCGAGGTGGAGAGCGACGAAGAGCAACCGAGGTTTCAATCTGCGGCTGACA AACGGGCTCATCATAATGCACTGGAACGAAAACGTAGGGACCACATCAAAGACAGCTTTC ACAGTTTGCGGGACTCAGTCCCATCACTCCAAGGAGAGAAGCTCTATTTCCTCTTTTGGA AATTGTGTACTCCTGTCCTTCATCGTCAAAGTTTGATGCAGAAATGCCACACCTTCATTT CAAGCTACCAAGTGCACAAGAAAAAAGAATGCAAGATTTAAAAAATGATTGTTTTGACCC CTTACACAAATGTCTTACTCCTGGCTTTAATTAAGCTGCTTGAGGGCTGATAGCTCTGCC TTTCCCTGGTAATCAGCAAAATGGTCCTGTGGCTGGGGAGGCCCTGGCAGCAGGAAGCCT TCAAGGAGCCATGGGTCTGTGCTGACTCTGGCCTTACAACCTTCCAGCCTCCTTTGCTGG CATTGATGGGGTTCCATTTTTGAATGAACTAGTTTAATGTGGATCCAAATTTATTGTGCA TATTCTTTCGTTTTGGTTTTCAAAAGATGGCTTATTCACATGGAAATGTACACCAGTTTA GCCCTGGGCCCTCCCTTTACCTTCATATGTGTAAAAGCTTACACAGGTTTCAGAAAATAA ATGGTTTCATTTTCTCTAAAATAACTAGTACAAAATAAAACAGATGTCAGTTGTTGAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | ECoRI-NOT |
ACCN | NM_145114 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_145114.1, NP_660089.1 |
RefSeq Size | 942 bp |
RefSeq ORF | 291 bp |
Locus ID | 4149 |
Cytogenetics | 14q23.3 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | MAPK signaling pathway, Pathways in cancer, Small cell lung cancer |
Gene Summary | 'The protein encoded by this gene is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell proliferation, differentiation and apoptosis. The homodimers and heterodimers compete for a common DNA target site (the E box) and rearrangement among these dimer forms provides a complex system of transcriptional regulation. Mutations of this gene have been reported to be associated with hereditary pheochromocytoma. A pseudogene of this gene is located on the long arm of chromosome 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]' Transcript Variant: This variant (4) lacks one alternate in-frame exon in the coding region and includes an alternate 3' terminal exon compared to variant 1. It encodes isoform d which is shorter and has a distinct C-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203944 | MAX (Myc-DDK-tagged)-Human MYC associated factor X (MAX), transcript variant 4 |
USD 98.00 |
|
RG203944 | MAX (GFP-tagged) - Human MYC associated factor X (MAX), transcript variant 4 |
USD 460.00 |
|
RC203944L3 | Lenti ORF clone of Human MYC associated factor X (MAX), transcript variant 4, Myc-DDK-tagged |
USD 620.00 |
|
RC203944L4 | Lenti ORF clone of Human MYC associated factor X (MAX), transcript variant 4, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review