NDUFB11 (NM_001135998) Human Untagged Clone

CAT#: SC324738

NDUFB11 (untagged)-Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa (NDUFB11), nuclear gene encoding mitochondrial protein, transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NDUFB11
• Synonyms: CI-ESSS; ESSS; MC1DN30; Np15; NP17.3; P17.3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001135998, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGCTGGGCTGTTTGGTTTGAGCGCTCGCCGTCTTTTGGCGGCAGCGGCGACGCGAGGGCTCCCGG
  CCGCCCGCGTCCGCTGGGAATCTAGCTTCTCCAGGACTGTGGTCGCCCCGTCCGCTGTGGCGGGAAAGCG
  GCCCCCAGAACCGACCACACCGTGGCAAGAGGACCCAGAACCCGAGGACGAAAACTTGTATGAGAAGAAC
  CCAGACTCCCATGGTTATGACAAGGACCCCGTTTTGGACGTCTGGAACATGCGACTTGTCTTCTTCTTTG
  GCGTCTCCATCATCCTGGTCCTTGGCAGCACCTTTGTGGCCTATCTGCCTGACTACAGGATGAAAGAGTG
  GTCCCGCCGCGAAGCTGAGAGGCTTGTGAAATACCGAGAGGCCAATGGCCTTCCCATCATGGAATCCAAC
  TGCTTCGACCCCAGCAAGATCCAGCTGCCAGAGGATGAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001135998
• ORF Size: 462 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001135998.2, NP_001129470.1
• RefSeq Size: 1108
• RefSeq ORF: 462
• Locus ID: 54539
• Protein Families: Transmembrane
• Gene Summary: The protein encoded by this gene is a subunit of the multisubunit NADH:ubiquinone oxidoreductase (complex I). Mammalian complex I is located at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to ubiquinone. Mutations in the human gene are associated with linear skin defects with multiple congenital anomalies 3 and mitochondrial complex I deficiency. [provided by RefSeq, Dec 2016]
  Transcript Variant: This variant (2) uses an alternate in_frame splice site in the 3' coding region, compared to variant 1. The encoded isoform (2) has a shorter C-terminus compared to isoform 1.