MYL12B (NM_001144945) Human Untagged Clone
CAT#: SC324760
MYL12B (untagged)-Human myosin, light chain 12B, regulatory (MYL12B), transcript variant 3
"NM_001144945" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MYL12B |
Synonyms | MLC-B; MRLC2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001144945, the custom clone sequence may differ by one or more nucleotides
ATGTCGAGCAAAAAGGCAAAGACCAAGACCACCAAGAAGCGCCCTCAGCGTGCAACATCCAATGTGTTTG CCATGTTTGACCAGTCACAGATTCAGGAGTTCAAAGAGGCCTTCAACATGATTGATCAGAACAGAGATGG CTTCATCGACAAGGAAGATTTGCATGATATGCTTGCTTCTCTAGGGAAGAATCCCACTGATGCATACCTT GATGCCATGATGAATGAGGCCCCAGGGCCCATCAATTTCACCATGTTCCTGACCATGTTTGGTGAGAAGT TAAATGGCACAGATCCTGAAGATGTCATCAGAAACGCCTTTGCTTGCTTTGATGAAGAAGCAACAGGCAC CATTCAGGAAGATTACCTAAGAGAGCTGCTGACAACCATGGGGGATCGGTTTACAGATGAGGAAGTGGAT GAGCTGTACAGAGAAGCACCTATTGACAAAAAGGGGAATTTCAATTACATCGAGTTCACACGCATCCTGA AACATGGAGCCAAAGACAAAGATGACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001144945 |
ORF Size | 519 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001144945.1, NP_001138417.1 |
RefSeq Size | 963 |
RefSeq ORF | 519 |
Locus ID | 103910 |
Protein Pathways | Focal adhesion, Leukocyte transendothelial migration, Regulation of actin cytoskeleton, Tight junction |
Gene Summary | The activity of nonmuscle myosin II (see MYH9; MIM 160775) is regulated by phosphorylation of a regulatory light chain, such as MRLC2. This phosphorylation results in higher MgATPase activity and the assembly of myosin II filaments (Iwasaki et al., 2001 [PubMed 11942626]). [supplied by OMIM, Mar 2008] Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1. Variants 1-3 all encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The extent of this RefSeq transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227002 | MYL12B (Myc-DDK-tagged)-Human myosin, light chain 12B, regulatory (MYL12B), transcript variant 3 |
USD 420.00 |
|
RG227002 | MYL12B (GFP-tagged) - Human myosin, light chain 12B, regulatory (MYL12B), transcript variant 3 |
USD 460.00 |
|
RC227002L1 | Lenti ORF clone of Human myosin, light chain 12B, regulatory (MYL12B), transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
RC227002L2 | Lenti ORF clone of Human myosin, light chain 12B, regulatory (MYL12B), transcript variant 3, mGFP tagged |
USD 620.00 |
|
RC227002L3 | Lenti ORF clone of Human myosin, light chain 12B, regulatory (MYL12B), transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
RC227002L4 | Lenti ORF clone of Human myosin, light chain 12B, regulatory (MYL12B), transcript variant 3, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review