CDKN3 (NM_001130851) Human Untagged Clone

CAT#: SC324761

CDKN3 (untagged)-Human cyclin-dependent kinase inhibitor 3 (CDKN3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CDKN3
• Synonyms: CDI1; CIP2; KAP; KAP1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001130851, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGCCGCCCAGTTCAATACAAACAAGTTGTAAATTTAAAGATGTTAGAAGAAATGTCCAAAAAGATA
  CAGAAGAACTAAAGAGCTGTGGTATACAAGACATATTTGTTTTCTGCACCAGAGGGGAACTGTCAAAATA
  TAGAGTCCCAAACCTTCTGGATCTCTACCAGCAATGTGGAATTATCACCCATCATCATCCAATCGCAGAT
  GGAGGGACTCCTGACATAGCCAGCTGCTGTGAAATAATGGAAGAGCTTACAACCTGCCTTAAAAATTACC
  GAAAAACCTTAATACACTGCTATGGAGGACTTGGGAGATCTTGTCTTGTAGCTGCTTGTCTCCTACTATA
  CCTGTCTGACACAATATCACCAGAGCAAGCCATAGACAGCCTGCGAGACCTAAGAGGATCCGGGGCAATA
  CAGACCATCAAGCAATACAATTATCTTCATGAGTTTCGGGACAAATTAGCTGCACATCTATCATCAAGAG
  ATTCACAATCAAGATCTGTATCAAGATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001130851
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001130851.1, NP_001124323.1
• RefSeq Size: 786 bp
• RefSeq ORF: 519 bp
• Locus ID: 1033
• Cytogenetics: 14q22.2
• Protein Families: Druggable Genome, Phosphatase
• Gene Summary: 'The protein encoded by this gene belongs to the dual specificity protein phosphatase family. It was identified as a cyclin-dependent kinase inhibitor, and has been shown to interact with, and dephosphorylate CDK2 kinase, thus prevent the activation of CDK2 kinase. This gene was reported to be deleted, mutated, or overexpressed in several kinds of cancers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]'
  Transcript Variant: This variant (2) lacks an in-frame segment in the CDS, as compared to variant 1. The resulting isoform (2) lacks an internal segment, as compared to isoform 1.