HMGB2 (NM_001130689) Human Untagged Clone

CAT#: SC324789

HMGB2 (untagged)-Human high mobility group box 2 (HMGB2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HMGB2
• Synonyms: HMG2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001130689, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGTAAAGGAGACCCCAACAAGCCGCGGGGCAAAATGTCCTCGTACGCCTTCTTCGTGCAGACCTGCC
  GGGAAGAGCACAAGAAGAAACACCCGGACTCTTCCGTCAATTTCGCGGAATTCTCCAAGAAGTGTTCGGA
  GAGATGGAAGACCATGTCTGCAAAGGAGAAGTCGAAGTTTGAAGATATGGCAAAAAGTGACAAAGCTCGC
  TATGACAGGGAGATGAAAAATTACGTTCCTCCCAAAGGTGATAAGAAGGGGAAGAAAAAGGACCCCAATG
  CTCCTAAAAGGCCACCATCTGCCTTCTTCCTGTTTTGCTCTGAACATCGCCCAAAGATCAAAAGTGAACA
  CCCTGGCCTATCCATTGGGGATACTGCAAAGAAATTGGGTGAAATGTGGTCTGAGCAGTCAGCCAAAGAT
  AAACAACCATATGAACAGAAAGCAGCTAAGCTAAAGGAGAAATATGAAAAGGATATTGCTGCATATCGTG
  CCAAGGGCAAAAGTGAAGCAGGAAAGAAGGGCCCTGGCAGGCCAACAGGCTCAAAGAAGAAGAACGAACC
  AGAAGATGAGGAGGAGGAGGAGGAAGAAGAAGATGAAGATGAGGAGGAAGAGGATGAAGATGAAGAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001130689
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001130689.1, NP_001124161.1
• RefSeq Size: 1454 bp
• RefSeq ORF: 630 bp
• Locus ID: 3148
• Cytogenetics: 4q34.1
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: 'This gene encodes a member of the non-histone chromosomal high mobility group protein family. The proteins of this family are chromatin-associated and ubiquitously distributed in the nucleus of higher eukaryotic cells. In vitro studies have demonstrated that this protein is able to efficiently bend DNA and form DNA circles. These studies suggest a role in facilitating cooperative interactions between cis-acting proteins by promoting DNA flexibility. This protein was also reported to be involved in the final ligation step in DNA end-joining processes of DNA double-strand breaks repair and V(D)J recombination. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1.