BDNF (NM_001143816) Human Untagged Clone

CAT#: SC324838

BDNF (untagged)-Human brain-derived neurotrophic factor (BDNF), transcript variant 16


  "NM_001143816" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "BDNF"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BDNF
Synonyms ANON2; BULN2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001143816, the custom clone sequence may differ by one or more nucleotides
ATGACCATCCTTTTCCTTACTATGGTTATTTCATACTTTGGTTGCATGAAGGCTGCCCCC
ATGAAAGAAGCAAACATCCGAGGACAAGGTGGCTTGGCCTACCCAGGTGTGCGGACCCAT
GGGACTCTGGAGAGCGTGAATGGGCCCAAGGCAGGTTCAAGAGGCTTGACATCATTGGCT
GACACTTTCGAACACGTGATAGAAGAGCTGTTGGATGAGGACCAGAAAGTTCGGCCCAAT
GAAGAAAACAATAAGGACGCAGACTTGTACACGTCCAGGGTGATGCTCAGTAGTCAAGTG
CCTTTGGAGCCTCCTCTTCTCTTTCTGCTGGAGGAATACAAAAATTACCTAGATGCTGCA
AACATGTCCATGAGGGTCCGGCGCCACTCTGACCCTGCCCGCCGAGGGGAGCTGAGCGTG
TGTGACAGTATTAGTGAGTGGGTAACGGCGGCAGACAAAAAGACTGCAGTGGACATGTCG
GGCGGGACGGTCACAGTCCTTGAAAAGGTCCCTGTATCAAAAGGCCAACTGAAGCAATAC
TTCTACGAGACCAAGTGCAATCCCATGGGTTACACAAAAGAAGGCTGCAGGGGCATAGAC
AAAAGGCATTGGAACTCCCAGTGCCGAACTACCCAGTCGTACGTGCGGGCCCTTACCATG
GATAGCAAAAAGAGAATTGGCTGGCGATTCATAAGGATAGACACTTCTTGTGTATGTACA
TTGACCATTAAAAGGGGAAGA
Restriction Sites Please inquire     
ACCN NM_001143816
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001143816.1, NP_001137288.1
RefSeq Size 4521 bp
RefSeq ORF 744 bp
Locus ID 627
Cytogenetics 11p14.1
Protein Families Adult stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Induced pluripotent stem cells, Secreted Protein, Transmembrane
Protein Pathways Huntington's disease, MAPK signaling pathway, Neurotrophin signaling pathway
Gene Summary 'This gene encodes a member of the nerve growth factor family of proteins. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protein. Binding of this protein to its cognate receptor promotes neuronal survival in the adult brain. Expression of this gene is reduced in Alzheimer's, Parkinson's, and Huntington's disease patients. This gene may play a role in the regulation of the stress response and in the biology of mood disorders. [provided by RefSeq, Nov 2015]'
Transcript Variant: This variant (16), also known as IXabd, differs in the 5' UTR compared to variant 1. Variants 1, 2, 4, 5, and 7-16 encode the same isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.