PNPLA4 (NM_001142389) Human Untagged Clone
CAT#: SC324854
PNPLA4 (untagged)-Human patatin-like phospholipase domain containing 4 (PNPLA4), transcript variant 2
"NM_001142389" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PNPLA4 |
Synonyms | DXS1283E; GS2; iPLA2eta |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001142389, the custom clone sequence may differ by one or more nucleotides
ATGAAGCACATCAACCTATCATTTGCAGCGTGTGGATTTCTGGGCATTTACCACTTGGGGGCAGCATCTG CACTTTGCAGACATGGCAAAAAACTTGTGAAGGATGTCAAAGCCTTCGCTGGGGCGTCTGCGGGATCGTT GGTTGCTTCTGTTCTGCTAACAGCACCAGAAAAAATAGAGGAATGTAACCAATTTACCTACAAGTTTGCC GAAGAAATCAGAAGGCAGTCTTTCGGGGCAGTAACGCCCGGTTATGACTTCATGGCCCGACTAAGAAGTG GGATGGAGTCGATTCTTCCTCCCAGCGCTCACGAGCTGGCCCAGAACCGACTGCACGTATCCATCACCAA CGCCAAAACCAGAGAAAATCACTTAGTCTCCACTTTTTCCTCCAGGGAGGACCTCATTAAGGTCCTCCTA GCCAGCAGTTTTGTGCCCATTTATGCAGGACTGAAGCTAGTGGAATACAAAGGGCAGAAGTGGGTGGACG GAGGCCTCACCAACGCTCTTCCCATCCTGCCCGTCGGCCGGACAGTAACCATCTCCCCCTTCAGTGGACG ACTGGACATCTCCCCGCAGGACAAAGGGCAGCTAGATCTGTATGTTAATATCGCCAAGCAGGATATCATG TTGTCCCTGGCAAACCTGGTGAGACTCAACCAAGCCCTTTTTCCCCCAAGCAAGAGGAAAATGGAATCTT TGTATCAGTGTGGTTTTGATGACACTGTTAAGTTTTTACTTAAAGAAAATTGGTTTGAATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001142389 |
ORF Size | 762 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001142389.1, NP_001135861.1 |
RefSeq Size | 2752 |
RefSeq ORF | 762 |
Locus ID | 8228 |
Protein Pathways | Retinol metabolism |
Gene Summary | This gene encodes a member of the patatin-like family of phospholipases. The encoded enzyme has both triacylglycerol lipase and transacylase activities and may be involved in adipocyte triglyceride homeostasis. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome Y. [provided by RefSeq, Feb 2010] Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same isoform (1). Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226698 | PNPLA4 (Myc-DDK-tagged)-Human patatin-like phospholipase domain containing 4 (PNPLA4), transcript variant 2 |
USD 420.00 |
|
RG226698 | PNPLA4 (GFP-tagged) - Human patatin-like phospholipase domain containing 4 (PNPLA4), transcript variant 2 |
USD 460.00 |
|
RC226698L1 | Lenti ORF clone of Human patatin-like phospholipase domain containing 4 (PNPLA4), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC226698L2 | Lenti ORF clone of Human patatin-like phospholipase domain containing 4 (PNPLA4), transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC226698L3 | Lenti ORF clone of Human patatin-like phospholipase domain containing 4 (PNPLA4), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC226698L4 | Lenti ORF clone of Human patatin-like phospholipase domain containing 4 (PNPLA4), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review