KCTD1 (NM_001136205) Human Untagged Clone
CAT#: SC324858
KCTD1 (untagged)-Human potassium channel tetramerisation domain containing 1 (KCTD1), transcript variant 1
"NM_001136205" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KCTD1 |
Synonyms | C18orf5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001136205, the custom clone sequence may differ by one or more nucleotides
ATGTCAAGACCTCTGATCACTAGATCCCCTGCATCTCCACTGAACAACCAAGGCATCCCTACTCCAGCAC AACTCACAAAATCCAATGCGCCTGTCCACATTGATGTGGGCGGCCACATGTACACCAGCAGCCTGGCCAC CCTCACCAAATACCCTGAATCCAGAATCGGAAGACTTTTTGATGGTACAGAGCCCATTGTTTTGGACAGT CTCAAACAGCACTATTTCATTGACAGAGATGGACAGATGTTCAGATATATCTTGAATTTTCTACGAACAT CCAAACTCCTCATTCCTGATGATTTCAAGGACTACACTTTGTTATATGAAGAGGCAAAATATTTTCAGCT TCAGCCCATGTTGTTGGAGATGGAAAGATGGAAGCAGGACAGAGAAACTGGTCGATTTTCAAGGCCCTGT GAGTGCCTCGTCGTGCGTGTGGCCCCAGACCTCGGAGAAAGGATCACGCTAAGCGGTGACAAATCCTTGA TAGAAGAAGTATTTCCAGAGATCGGCGACGTGATGTGTAACTCTGTCAATGCAGGCTGGAATCACGACTC GACGCACGTCATCAGGTTTCCACTAAATGGCTACTGTCACCTCAACTCAGTCCAGGTCCTCGAGAGGTTG CAGCAAAGAGGATTTGAAATCGTGGGCTCCTGTGGGGGAGGAGTAGACTCGTCCCAGTTCAGCGAATACG TCCTTCGGCGGGAACTGAGGCGGACGCCCCGTGTACCCTCCGTCATCCGGATAAAGCAAGAGCCTCTGGA CTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001136205 |
ORF Size | 774 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001136205.2, NP_001129677.1 |
RefSeq Size | 2174 |
RefSeq ORF | 774 |
Locus ID | 284252 |
Protein Families | Ion Channels: Other |
Gene Summary | This gene encodes a protein containing a BTB (Broad-complex, tramtrack and bric a brac), also known as a POZ (POxvirus and zinc finger) protein-protein interaction domain. The encoded protein negatively regulates the AP-2 family of transcription factors and the Wnt signaling pathway. A mechanism for the modulation of Wnt signaling has been proposed in which the encoded protein enhances ubiquitination and degradation of the beta-catenin protein. Mutations in this gene have been identified in Scalp-ear-nipple (SEN) syndrome. [provided by RefSeq, May 2017] Transcript Variant: This variant (1) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 3. Variants 1, 2, 4 and 6 all encode the same isoform (a), which has a shorter N-terminus compared to isoform b. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226740 | KCTD1 (Myc-DDK-tagged)-Human potassium channel tetramerisation domain containing 1 (KCTD1), transcript variant 1 |
USD 420.00 |
|
RG226740 | KCTD1 (GFP-tagged) - Human potassium channel tetramerisation domain containing 1 (KCTD1), transcript variant 1 |
USD 460.00 |
|
RC226740L3 | Lenti ORF clone of Human potassium channel tetramerisation domain containing 1 (KCTD1), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC226740L4 | Lenti ORF clone of Human potassium channel tetramerisation domain containing 1 (KCTD1), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review