KCNK16 (NM_001135105) Human Untagged Clone

CAT#: SC324944

KCNK16 (untagged)-Human potassium channel, subfamily K, member 16 (KCNK16), transcript variant 1


  "NM_001135105" in other vectors (6)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "KCNK16"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KCNK16
Synonyms K2p16.1; TALK-1; TALK1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001135105, the custom clone sequence may differ by one or more nucleotides


ATGCCCAGTGCTGGGCTCTGCAGCTGCTGGGGTGGCCGGGTGCTGCCCCTGCTGCTGGCCTATGTCTGCT
ACCTGCTGCTCGGTGCCACTATCTTCCAGCTGCTAGAGAGGCAGGCGGAGGCTCAGTCCAGGGACCAGTT
TCAGTTGGAGAAGCTGCGCTTCCTGGAGAACTACACCTGCCTGGACCAGTGGGCCATGGAGCAGTTTGTG
CAGGTCATCATGGAAGCCTGGGTGAAAGGTGTGAACCCCAAAGGCAACTCTACCAACCCCAGCAACTGGG
ACTTTGGCAGCAGTTTCTTCTTTGCAGGCACAGTCGTCACTACCATAGGATATGGGAACCTGGCACCCAG
CACAGAGGCAGGTCAGGTCTTCTGTGTCTTCTATGCCCTGTTGGGCATCCCGCTTAACGTGATCTTCCTC
AACCACCTGGGCACAGGGCTGCGTGCCCATCTGGCCGCCATTGAAAGATGGGAGGACCGTCCCAGGCGCT
CCCAGGTACTGCAAGTCCTGGGCCTGGCTCTGTTCCTGACCCTGGGGACGCTGGTCATTCTCATCTTCCC
ACCCATGGTCTTCAGCCATGTGGAGGGCTGGAGCTTCAGCGAGGGCTTCTACTTTGCTTTCATCACTCTC
AGCACCATTGGCTTTGGGGACTATGTTGTTGGCCACCCCCTTAACTTCATCACTCCCTCTGGGCTCCTGC
CTTCTCAAGAGCCTTTCCAAACACCCCATGGGAAGCCAGAGAGCCAGCAGATCCCAGGATCCTTCCAGAA
AGTGAGCTCCATGAACGTCTGGCCTCTCTCAGGAATGCATTCTCCAGGTCTGGCCTTTCCCCTGCCAGAC
TGCAACATCCCTGACCAGGAGAGATTTAGACCACTCCATCCCGGGGCCTGGAAATTTTGGCCTTTGCCTC
TCCCATCATCCAACAGCAAGTGGGCTCCTATGTGGCTGGGTTCCTCTGCACAGGTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001135105
ORF Size 969 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001135105.1, NP_001128577.1
RefSeq Size 1412
RefSeq ORF 969
Locus ID 83795
Protein Families Druggable Genome, Ion Channels: Potassium, Transmembrane
Gene Summary The protein encoded by this gene belongs to the family of potassium channel proteins containing two pore-forming P domains. This channel is an open rectifier which primarily passes outward current under physiological K+ concentrations. This gene is expressed predominantly in the pancreas and is activated at alkaline pH. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Sep 2008]
Transcript Variant: This variant (1, also known as TALK-1c) encodes the longest isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.