Parvin gamma (PARVG) (NM_001137605) Human Untagged Clone

CAT#: SC324949

PARVG (untagged)-Human parvin, gamma (PARVG), transcript variant 2


  "NM_001137605" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PARVG"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PARVG
Synonyms AI413459; gamma-parvin; OTTMUSP00000032048; parvin, gamma
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001137605, the custom clone sequence may differ by one or more nucleotides


ATGGAGCCGGAGTTCTTGTACGACCTGCTGCAGCTCCCCAAGGGGGTGGAGCCCCCAGCGGAGGAGGAGC
TCTCAAAAGGAGGAAAGAAGAAATACCTGCCACCCACTTCCCGGAAGGACCCCAAATTTGAAGAACTGCA
GAAGGTGTTGATGGAGTGGATCAATGCCACTCTTCTCCCCGAGCACATTGTGGTCCGCAGCCTGGAGGAG
GACATGTTCGACGGGCTCATCCTACACCACCTATTCCAGAGGCTGGCGGCGCTCAAGCTGGAAGCAGAGG
ACATCGCCCTGACAGCCACAAGCCAGAAGCACAAGCTCACAGTGGTGCTGGAGGCCGTGAACCGGAGTCT
GCAGCTGGAGGAGTGGCAGGCCAAGTGGAGCGTGGAGAGCATCTTCAACAAGGACCTGTTGTCTACCCTG
CACCTCCTTGTGGCCCTGGCCAAGCGCTTCCAGCCCGACCTCTCCCTCCCAACCAACGTCCAGGTGGAGG
TCATCACTATCGAGAGCACCAAAAGTGGTCTGAAGTCAGAGAAGTTGGTGGAACAGCTCACTGAATACAG
CACAGACAAGGACGAGCCTCCAAAGGACGTCTTTGATGAATTATTTAAGCTGGCTCCGGAGAAAGTGAAC
GCAGTGAAAGAGGCCATCGTGAACTTTGTCAACCAGAAGCTGGACCGCCTGGGCCTGTCTGTGCAGAATC
TGGACACCCAGTTTGCAGATGGGGTCATCTTACTCTTGCTGATTGGACAACTTGAAGGCTTCTTCCTGCA
CTTAAAGGAATTCTACCTCACTCCCAACTCTCCTGCAGAAATGCTGCACAACGTCACCCTGGCGCTGGAG
CTGCTGAAGGACGAGGGCCTGCTCAGCTGCCCTGTCAGCCCTGAAGATATCGTGAACAAGGATGCCAAGA
GCACACTGAGGGTGCTCTATGGTCTGTTCTGCAAGCACACGCAGAAGGCACACAGGGACAGGACGCCCCA
TGGAGCCCCGAATTGA


Restriction Sites SgfI-MluI     
ACCN NM_001137605
ORF Size 996 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001137605.2, NP_001131077.1
RefSeq Size 3475
RefSeq ORF 996
Locus ID 64098
Protein Pathways Adherens junction, Arrhythmogenic right ventricular cardiomyopathy (ARVC), Dilated cardiomyopathy, Focal adhesion, Hypertrophic cardiomyopathy (HCM), Leukocyte transendothelial migration, Pathogenic Escherichia coli infection, Regulation of actin cytoskeleton, Tight junction, Vibrio cholerae infection, Viral myocarditis
Gene Summary Members of the parvin family, including PARVG, are actin-binding proteins associated with focal contacts. [supplied by OMIM, Aug 2004]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. This variant lacks full-length support and thus it has an inferred exon combination; the alternate 5' exon, which extends the gene range, is well-supported by partial transcript data. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.