PTPN18 (NM_001142370) Human Untagged Clone
CAT#: SC324985
PTPN18 (untagged)-Human protein tyrosine phosphatase, non-receptor type 18 (brain-derived) (PTPN18), transcript variant 2
"NM_001142370" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PTPN18 |
Synonyms | BDP1; PTP-HSCF |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001142370, the custom clone sequence may differ by one or more nucleotides
ATGAGCCGCAGCCTGGACTCGGCGCGGAGCTTCCTGGAGCGGCTGGAAGCGCGGGGCGGCCGGGAGGGGG CAGTCCTCGCCGGCGAGTTCAGCAAAAGGTGTGAGCGGTACTGGGCCCAGGAGCAGGAGCCACTGCAGAC TGGGCTTTTCTGCATCACTCTGATAAAGGAGAAGTGGCTGAATGAGGACATCATGCTCAGGACCCTCAAG GTCACATTCCAGAAGGAGTCCCGTTCTGTGTACCAGCTACAGTATATGTCCTGGCCAGACCGTGGGGTCC CCAGCAGTCCTGACCACATGCTCGCCATGGTGGAGGAAGCCCGTCGCCTCCAGGGATCTGGCCCTGAACC CCTCTGTGTCCACTGCAGTGCGGGTTGTGGGCGAACAGGCGTCCTGTGCACCGTGGATTATGTGAGGCAG CTGCTCCTGACCCAGATGATCCCACCTGACTTCAGTCTCTTTGATGTGGTCCTTAAGATGAGGAAGCAGC GGCCTGCGGCCGTGCAGACAGAGGAGCAGTACAGGTTCCTGTACCACACGGTGGCTCAGATGTTCTGCTC CACACTCCAGAATGCCAGCCCCCACTACCAGAACATCAAAGAGAATTGTGCCCCACTCTACGACGATGCC CTCTTCCTCCGGACTCCCCAGGCACTTCTCGCCATACCCCGCCCACCAGGAGGGGTCCTCAGGAGCATCT CTGTGCCCGGGTCCCCGGGCCACGCCATGGCTGACACCTACGCGGTGGTGCAGAAGCGCGGGGCTCCAGC GGGCGCCGGGAGTGGGACGCAGACGGGGACGGGGACGGGGACGGGGGCGCGCAGCGCGGAGGAGGCGCCG CTCTACAGCAAGGTGACGCCGCGCGCCCAGCGACCCGGGGCGCACGCGGAGGACGCGAGGGGGACGCTGC CTGGCCGCGTTCCTGCTGACCAAAGTCCTGCCGGATCTGGCGCCTACGAGGACGTGGCGGGTGGAGCTCA GACCGGTGGGCTAGGTTTCAACCTGCGCATTGGGAGGCCGAAGGGTCCCCGGGACCCGCCTGCTGAGTGG ACCCGGGTGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001142370 |
ORF Size | 1062 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001142370.1, NP_001135842.1 |
RefSeq Size | 3365 |
RefSeq ORF | 1062 |
Locus ID | 26469 |
Protein Families | Druggable Genome, Phosphatase |
Gene Summary | The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, the mitotic cycle, and oncogenic transformation. This PTP contains a PEST motif, which often serves as a protein-protein interaction domain, and may be related to protein intracellular half-live. This protein can differentially dephosphorylate autophosphorylated tyrosine kinases that are overexpressed in tumor tissues, and it appears to regulate HER2, a member of the epidermal growth factor receptor family of receptor tyrosine kinases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008] Transcript Variant: This variant (2) lacks four internal exons in the 5' coding region that results in the loss of an in-frame segment, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226517 | PTPN18 (Myc-DDK-tagged)-Human protein tyrosine phosphatase, non-receptor type 18 (brain-derived) (PTPN18), transcript variant 2 |
USD 420.00 |
|
RG226517 | PTPN18 (GFP-tagged) - Human protein tyrosine phosphatase, non-receptor type 18 (brain-derived) (PTPN18), transcript variant 2 |
USD 460.00 |
|
RC226517L1 | Lenti ORF clone of Human protein tyrosine phosphatase, non-receptor type 18 (brain-derived) (PTPN18), transcript variant 2, Myc-DDK-tagged |
USD 768.00 |
|
RC226517L2 | Lenti ORF clone of Human protein tyrosine phosphatase, non-receptor type 18 (brain-derived) (PTPN18), transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC226517L3 | Lenti ORF clone of Human protein tyrosine phosphatase, non-receptor type 18 (brain-derived) (PTPN18), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC226517L4 | Lenti ORF clone of Human protein tyrosine phosphatase, non-receptor type 18 (brain-derived) (PTPN18), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review