SQSTM1 (NM_001142298) Human Untagged Clone

CAT#: SC324988

SQSTM1 (untagged)-Human sequestosome 1 (SQSTM1), transcript variant 2


  "NM_001142298" in other vectors (4)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SQSTM1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SQSTM1
Synonyms A170; DMRV; FTDALS3; NADGP; OSIL; p60; p62; p62B; PDB3; ZIP3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001142298, the custom clone sequence may differ by one or more nucleotides


ATGGCCATGTCCTACGTGAAGGATGACATCTTCCGAATCTACATTAAAGAGAAAAAAGAGTGCCGGCGGG
ACCACCGCCCACCGTGTGCTCAGGAGGCGCCCCGCAACATGGTGCACCCCAATGTGATCTGCGATGGCTG
CAATGGGCCTGTGGTAGGAACCCGCTACAAGTGCAGCGTCTGCCCAGACTACGACTTGTGTAGCGTCTGC
GAGGGAAAGGGCTTGCACCGGGGGCACACCAAGCTCGCATTCCCCAGCCCCTTCGGGCACCTGTCTGAGG
GCTTCTCGCACAGCCGCTGGCTCCGGAAGGTGAAACACGGACACTTCGGGTGGCCAGGATGGGAAATGGG
TCCACCAGGAAACTGGAGCCCACGTCCTCCTCGTGCAGGGGAGGCCCGCCCTGGCCCCACGGCAGAATCA
GCTTCTGGTCCATCGGAGGATCCGAGTGTGAATTTCCTGAAGAACGTTGGGGAGAGTGTGGCAGCTGCCC
TTAGCCCTCTGGGCATTGAAGTTGATATCGATGTGGAGCACGGAGGGAAAAGAAGCCGCCTGACCCCCGT
CTCTCCAGAGAGTTCCAGCACAGAGGAGAAGAGCAGCTCACAGCCAAGCAGCTGCTGCTCTGACCCCAGC
AAGCCGGGTGGGAATGTTGAGGGCGCCACGCAGTCTCTGGCGGAGCAGATGAGGAAGATCGCCTTGGAGT
CCGAGGGGCGCCCTGAGGAACAGATGGAGTCGGATAACTGTTCAGGAGGAGATGATGACTGGACCCATCT
GTCTTCAAAAGAAGTGGACCCGTCTACAGGTGAACTCCAGTCCCTACAGATGCCAGAATCCGAAGGGCCA
AGCTCTCTGGACCCCTCCCAGGAGGGACCCACAGGGCTGAAGGAAGCTGCCTTGTACCCACATCTCCCGC
CAGAGGCTGACCCGCGGCTGATTGAGTCCCTCTCCCAGATGCTGTCCATGGGCTTCTCTGATGAAGGCGG
CTGGCTCACCAGGCTCCTGCAGACCAAGAACTATGACATCGGAGCGGCTCTGGACACCATCCAGTATTCA
AAGCATCCCCCGCCGTTGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001142298
ORF Size 1071 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001142298.1, NP_001135770.1
RefSeq Size 2931
RefSeq ORF 1071
Locus ID 8878
Protein Families Druggable Genome, Transcription Factors
Gene Summary This gene encodes a multifunctional protein that binds ubiquitin and regulates activation of the nuclear factor kappa-B (NF-kB) signaling pathway. The protein functions as a scaffolding/adaptor protein in concert with TNF receptor-associated factor 6 to mediate activation of NF-kB in response to upstream signals. Alternatively spliced transcript variants encoding either the same or different isoforms have been identified for this gene. Mutations in this gene result in sporadic and familial Paget disease of bone. [provided by RefSeq, Mar 2009]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation from an in-frame downstream start codon compared to variant 1. This results in an isoform (2) with a shorter N-terminus compared to isoform 1. Variants 2 and 3 encode the same isoform.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.