MTLRP (GHRL) (NM_001134944) Human Untagged Clone

CAT#: SC325462

GHRL (untagged)-Human ghrelin/obestatin prepropeptide (GHRL), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GHRL
• Synonyms: MTLRP
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001134944, the custom clone sequence may differ by one or more nucleotides
  ATGTTTACTTGCTGGTGGTCTTATCTAAGATCAACATTGGCAGCTGTGCCCGGAGAGGCC
  TCCAGGGTCCAGCAGAGAAAGGAGTCGAAGAAGCCACCAGCCAAGCTGCAGCCCCGAGCT
  CTAGCAGGCTGGCTCCGCCCGGAAGATGGAGGTCAAGCAGAAGGGGCAGAGGATGAACTG
  GAAGTCCGGTTCAACGCCCCCTTTGATGTTGGAATCAAGCTGTCAGGGGTTCAGTACCAG
  CAGCACAGCCAGGCCCTGGGGAAGTTTCTTCAGGACATCCTCTGGGAAGAGGCCAAAGAG
  GCCCCAGCCGACAAG
  
• Restriction Sites: Please inquire
• ACCN: NM_001134944
• ORF Size: 318 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001134944.1, NP_001128416.1
• RefSeq Size: 501
• RefSeq ORF: 318
• Locus ID: 51738
• Protein Families: Druggable Genome, Secreted Protein, Transmembrane
• Gene Summary: This gene encodes the ghrelin-obestatin preproprotein that is cleaved to yield two peptides, ghrelin and obestatin. Ghrelin is a powerful appetite stimulant and plays an important role in energy homeostasis. Its secretion is initiated when the stomach is empty, whereupon it binds to the growth hormone secretagogue receptor in the hypothalamus which results in the secretion of growth hormone (somatotropin). Ghrelin is thought to regulate multiple activities, including hunger, reward perception via the mesolimbic pathway, gastric acid secretion, gastrointestinal motility, and pancreatic glucose-stimulated insulin secretion. It was initially proposed that obestatin plays an opposing role to ghrelin by promoting satiety and thus decreasing food intake, but this action is still debated. Recent reports suggest multiple metabolic roles for obestatin, including regulating adipocyte function and glucose metabolism. Alternative splicing results in multiple transcript variants. In addition, antisense transcripts for this gene have been identified and may potentially regulate ghrelin-obestatin preproprotein expression. [provided by RefSeq, Nov 2014]
  Transcript Variant: This variant (3) lacks two alternate in-frame exons in the 5' coding region but maintains the reading frame, compared to variant 1. The resulting isoform (3) is shorter compared to isoform 1 and lacks the N-terminal region that encodes the signal peptide and ghrelin-28 ligand found in isoform 1.