RPS24 (NM_001142283) Human Untagged Clone

CAT#: SC325496

RPS24 (untagged)-Human ribosomal protein S24 (RPS24), transcript variant e


  "NM_001142283" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "RPS24"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RPS24
Synonyms DBA3; eS24; S24
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001142283, the custom clone sequence may differ by one or more nucleotides
ATGAACGACACCGTAACTATCCGCACTAGAAAGTTCATGACCAACCGACTACTTCAGAGG
AAACAAATGGTCATTGATGTCCTTCACCCCGGGAAGGCGACAGTGCCTAAGACAGAAATT
CGGGAAAAACTAGCCAAAATGTACAAGACCACACCGGATGTCATCTTTGTATTTGGATTC
AGAACTCATTTTGGTGGTGGCAAGACAACTGGCTTTGGCATGATTTATGATTCCCTGGAT
TATGCAAAGAAAAATGAACCCAAACATAGACTTGCAAGACATGGCCTGTATGAGAAGAAA
AAGACCTCAAGAAAGCAACGAAAGGAACGCAAGAACAGAATGAAGAAAGTCAGGGGGACT
GCAAAGGCCAATGTTGGTGCTGGCAAAAAGAAGAAA
Restriction Sites Please inquire     
ACCN NM_001142283
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001142283.1, NP_001135755.1
RefSeq Size 692 bp
RefSeq ORF 399 bp
Locus ID 6229
Cytogenetics 10q22.3
Protein Pathways Ribosome
Gene Summary 'Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S24E family of ribosomal proteins. It is located in the cytoplasm. Multiple transcript variants encoding different isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Mutations in this gene result in Diamond-Blackfan anemia. [provided by RefSeq, Nov 2008]'
Transcript Variant: This variant (e) uses an alternate splice pattern in the 3' coding region, compared to variant d. The resulting protein (isoform e) has a shorter and distinct C-terminus, compared to isoform d.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.