CD164 (NM_001142404) Human Untagged Clone

CAT#: SC325529

CD164 (untagged)-Human CD164 molecule, sialomucin (CD164), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CD164
• Synonyms: DFNA66; endolyn; MGC-24; MGC-24v; MUC-24
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001142404, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCGCGGCTCTCCCGCTCACTGCTTTGGGCCGCCACCTGCCTGGGCGTGCTCTGCGTGCTGTCCGCGG
  ACAAGAACACGACCCAGCACCCGAACGTGACGACTTTAGCGCCCATCTCCAACGTAACCTCGGCGCCGGT
  GACGTCCCTCCCGCTGGTCACCACTCCGGCACCAGAAACCTGTGAAGGTCGAAACAGCTGCGTTTCCTGT
  TTTAATGTTAGCGTTGTTAATACTACCTGCTTTTGGATAGAATGTAAAGATGAGAGCTATTGTTCACATA
  ACTCAACAGTTAGTGATTGTCAAGTGGGGAACACGACAGACTTCTGTTCCGTTTCCACGGCCACTCCAGT
  GCCAACAGCCAATTCTACAGCTAAACCCACAGTTCAGCCCTCCCCTTCTACAACTTCCAAGACAGTTACT
  ACATCAGAAATAAGATGCCACACAAGGAACTACATTCCAGATTTAAAGAAATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001142404
• ORF Size: 474 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001142404.1, NP_001135876.1
• RefSeq Size: 2429
• RefSeq ORF: 474
• Locus ID: 8763
• Protein Families: Secreted Protein, Transmembrane
• Protein Pathways: Lysosome
• Gene Summary: This gene encodes a transmembrane sialomucin and cell adhesion molecule that regulates the proliferation, adhesion and migration of hematopoietic progenitor cells. The encoded protein also interacts with the C-X-C chemokine receptor type 4 and may regulate muscle development. Elevated expression of this gene has been observed in human patients with Sezary syndrome, a type of blood cancer, and a mutation in this gene may be associated with impaired hearing. [provided by RefSeq, Oct 2016]
  Transcript Variant: This variant (5) uses an alternate splice site in the 3' coding region, compared to variant 1. It encodes isoform 5 which is shorter and has a distinct C-terminus, compared to isoform 1.