Acid Phosphatase 2 (ACP2) (NM_001131064) Human Untagged Clone

CAT#: SC325537

ACP2 (untagged)-Human acid phosphatase 2, lysosomal (ACP2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ACP2
• Synonyms: acid phosphatase 2, lysosomal; Acp-2; LAP; OTTMUSP00000015308
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001131064, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGGCAAGCGGTCCGGCTGGAGCCGGGCGGCTCTCCTCCAGCTCCTTCTCGGCGTGAACCTGGTGG
  TGATGCCGCCCACCCGGGCCCGGAGTCTGCGCTTCGTTACCTTGCTGTACCGCCATGGAGACCGTTCACC
  AGTGAAGACATATCCCAAGGACCCCTATCAGGAAGAAGAATGGCCCCAGGGGTTTGGTCAGTTAACCAAG
  GAGGGGATGCTACAGCACTGGGAACTGGGCCAGGCCCTGCGGCAGCGCTATCACGGCTTCCTAAACACCT
  CTTATCACCGGCAAGAGGTTTATGTGCGAAGCACAGACTTTGACCGGACTCTCATGAGTGCTGAGGCCAA
  CCTGGCTGGACTCTTCCCTCCCAACGGGATGCAGCGCTTCAACCCGAACATCTCGTGGCAGCCTATTCCT
  GTGCACACTGTGCCCATCACTGAGGACAGGGTAAGAGTGGCCAGCCCTTCCCTGGGGTGGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001131064
• ORF Size: 483 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001131064.1, NP_001124536.1
• RefSeq Size: 730
• RefSeq ORF: 483
• Locus ID: 53
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Lysosome, Riboflavin metabolism
• Gene Summary: The protein encoded by this gene belongs to the histidine acid phosphatase family, which hydrolyze orthophosphoric monoesters to alcohol and phosphate. This protein is localized to the lysosomal membrane, and is chemically and genetically distinct from the red cell acid phosphatase. Mice lacking this gene showed multiple defects, including bone structure alterations, lysosomal storage defects, and an increased tendency towards seizures. An enzymatically-inactive allele of this gene in mice showed severe growth retardation, hair-follicle abnormalities, and an ataxia-like phenotype. Alternatively spliced transcript variants have been found for this gene. A C-terminally extended isoform is also predicted to be produced by the use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism. [provided by RefSeq, Oct 2017]
  Transcript Variant: This variant uses a different splice site in the 3' coding region and is much shorter, compared to variant 1. The predicted protein (isoform 2) has a shorter and distinct C-terminus when it is compared to isoform 1.