WIBG (PYM1) (NM_001143853) Human Untagged Clone

CAT#: SC325597

WIBG (untagged)-Human within bgcn homolog (Drosophila) (WIBG), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PYM1
• Synonyms: PYM; WIBG
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001143853, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGACTCCCTATGTTACTGACGAGACCGGCGGCAAGTATATCGCGTCAACACAGCGACCTGACGGGA
  CCTGGCGCAAGCAGCGGAGGGTGAAAGAAGGATATGTGCCCCAGGAGGAGGTCCCAGTATATGAAAACAA
  GTATGTGAAGTTTTTCAAGAGTAAACCAGAGTTGCCCCCAGGGCTAAGCCCTGAGGCCACTGCTCCTGTC
  ACCCCATCCAGGCCTGAAGGTGGTGAACCAGGCCTCTCCAAGACAGCCAAACGTAACCTGAAGCGAAAGG
  AGAAGAGGCGGCAGCAGCAAGAGAAAGGAGAGGCAGAGGCCTTGAGCAGGACTCTTGATAAGGTGTCCCT
  GGAAGAGACAGCCCAACTCCCCAGTGCTCCACAGGGCTCTCGGGCAGCCCCCACAGCTGCATCTGACCAG
  CCTGACTCAGCTGCCACCACTGAGAAAGCCAAGAAGATAAAGAACCTAAAGAAGAAACTCCGGCAGGTGG
  AAGAGCTGCAGCAGCGGATCCAGGCTGGGGAAGTCAGCCAGCCCAGCAAAGAGCAGCTAGAAAAGCTAGC
  AAGGAGGAGGGCGCTAGAAGAGGAGTTAGAGGACTTGGAGTTAGGCCTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001143853
• ORF Size: 612 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001143853.1, NP_001137325.1
• RefSeq Size: 1105
• RefSeq ORF: 612
• Locus ID: 84305
• Gene Summary: Key regulator of the exon junction complex (EJC), a multiprotein complex that associates immediately upstream of the exon-exon junction on mRNAs and serves as a positional landmark for the intron exon structure of genes and directs post-transcriptional processes in the cytoplasm such as mRNA export, nonsense-mediated mRNA decay (NMD) or translation. Acts as an EJC disassembly factor, allowing translation-dependent EJC removal and recycling by disrupting mature EJC from spliced mRNAs. Its association with the 40S ribosomal subunit probably prevents a translation-independent disassembly of the EJC from spliced mRNAs, by restricting its activity to mRNAs that have been translated. Interferes with NMD and enhances translation of spliced mRNAs, probably by antagonizing EJC functions. May bind RNA; the relevance of RNA-binding remains unclear in vivo, RNA-binding was detected by PubMed:14968132, while PubMed:19410547 did not detect RNA-binding activity independently of the EJC. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) is 1 aa shorter and has a distinct N-terminus compared to isoform 1.