ECSIT (NM_001142465) Human Untagged Clone

CAT#: SC325617

ECSIT (untagged)-Human ECSIT homolog (Drosophila) (ECSIT), nuclear gene encoding mitochondrial protein, transcript variant 3


  "NM_001142465" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ECSIT"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ECSIT
Synonyms SITPEC
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001142465, the custom clone sequence may differ by one or more nucleotides


ATGAGCTGGGTCCAGGCCACCCTACTGGCCCGAGGCCTCTGTAGGGCCTGGGGAGGCACCTGCGGGGCCG
CCCTCACAGGAACCTCCATCTCTCAGGTTCCTTTGCCCAAAGACTCAACAGGTGCAGCAGATCCCCCCCA
GCCCCACATCGTAGGAATCCAGAGTCCCGATCAGCAGGCCGCCCTGGCCCGCCACAATCCAGCCCGGCCT
GTCTTTGTTGAGGGCCCCTTCTCCCTGTGGCTCCGCAACAAGTGTGTGTATTACCACATCCTCAGAGCTG
ACTTGCTGCCCCCGGAGGAGAGGGAAGTGGAAGAGACGCCGGAGGAGTGGAACCTCTACTACCCGATGCA
GCTGGACCTGGAGTATGTGAGGAGTGGCTGGGACAACTACGAGTTTGACATCAATGAAGTGGAGGAAGGC
CCTGTCTTCGCCATGTGCATGGCGGGTGCTCATGACCAGGCGACGATGGCTAAGTGGATCCAGGGCCTGC
AGGAGACCAACCCAACCCTGGCCCAGATCCCCGTGGTCTTCCGCCTCGCCGGGTCCACCCGGGAGCTCCA
GACATCCTCTGCAGGGCTGGAGGAGCCGCCCCTGCCCGAGGACCACCAGGAAGAAGACGACAACCTGCAG
CGACAGCAGCAGGGCCAGAGCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001142465
ORF Size 654 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001142465.2, NP_001135937.1
RefSeq Size 1068
RefSeq ORF 654
Locus ID 51295
Protein Pathways MAPK signaling pathway
Gene Summary Required for efficient assembly of mitochondrial NADH:ubiquinone oxidoreductase. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) lacks two consecutive exons in the coding region but maintains the reading frame, compared to variant 1. The encoded isoform (3) is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.