CHAC1 (NM_001142776) Human Untagged Clone

CAT#: SC325621

CHAC1 (untagged)-Human ChaC, cation transport regulator homolog 1 (E. coli) (CHAC1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CHAC1
• Synonyms: MGC4504
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001142776, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGGGGCGCTCAGCTGGAGCTACCGAGCGGTGCCAGGCCAGGTGTGTGCGTCCGTCGGTCTTTCCGTG
  CCCACGCCGGAGACCAGCCCCGGAGGCCGCCTGGGCCTATCCCTGTGCCAGGCACCATGAAGCAGGAGTC
  TGCAGCCCCGAACACCCCGCCCACCTCGCAGTCCCCTACGCCGTCCGCTCAGTTCCCCCGAAACGACGGC
  GACCCTCAAGCGCTGTGGATTTTCGGGTACGGCTCCCTGGTGTGGAGGCCCGACTTCGCCTACAGCGACA
  GCCGTGTGGGCTTCGTGCGCGGCTACAGCCGCCGTTTCTGGCAGGGAGACACCTTCCATCGGGGCAGCGA
  CAAGATGCCTGGCCGTGTGGTGACGCTCCTTGAAGATCATGAGGGCTGCACTTGGGGCGTGGCATACCAA
  GTGCAAGGGGAGCAGAACCCTGGTTACCTGGGCCCTGCGCCTGAAGAGGCCATTGCCACGCAGATCCTGG
  CCTGCCGGGGCTTCTCCGGCCACAACCTTGAATACTTGCTGCGTCTGGCAGACTTCATGCAGCTCTGTGG
  GCCTCAGGCGCAGGACGAGCACCTGGCAGCCATCGTGGACGCTGTGGGCACCATGTTGCCCTGCTTCTGC
  CCCACCGAGCAGGCTCTGGCGCTGGTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001142776
• ORF Size: 660 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001142776.1, NP_001136248.1
• RefSeq Size: 1443
• RefSeq ORF: 660
• Locus ID: 79094
• Gene Summary: This gene encodes a member of the gamma-glutamylcyclotransferase family of proteins. The encoded protein has been shown to promote neuronal differentiation by deglycination of the Notch receptor, which prevents receptor maturation and inhibits Notch signaling. This protein may also play a role in the unfolded protein response, and in regulation of glutathione levels and oxidative balance in the cell. Elevated expression of this gene may indicate increased risk of cancer recurrence among breast and ovarian cancer patients. [provided by RefSeq, Sep 2016]
  Transcript Variant: This variant (2) lacks an alternate in-frame segment, compared to variant 1, resulting in a shorter protein (isoform b), compared to isoform a. CCDS Note: The coding region has been updated to trim the N-terminus to one that is more supported by available transcript data, CAGE data and conservation data.