DERL1 (NM_001134671) Human Untagged Clone

CAT#: SC325637

DERL1 (untagged)-Human Der1-like domain family, member 1 (DERL1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DERL1
• Synonyms: DER-1; DER1; derlin-1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001134671, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCGGACATCGGAGACTGGTTCAGGAGCATCCCGGCGATCACGCGCTATTGGTTCGCCGCCACCGTCG
  CCGTGCCCTTGGTCGGCAAACTCGGCCTCATCAGCCCGGCCTACCTCTTCCTCTGGCCCGAAGCCTTCCT
  TTATCGCTTTCAGATTTGGAGGCCAATCACTGCCACCTTTTATTTCCCTGTGGGTCCAGGAACTGGATTT
  CTTTATTTGGTCAATTTATATTTCTTATATCAGTATTCTACGCGACTTGAAACAGGAGCTTTTGATGGGA
  GGCCAGCAGACTATTTATTCATGCTCCTCTTTAACTGGATTTGCATCGTGATTACTGGCTTAGCAATGGA
  TATGCAGTTGCTGATGATTCCTCTGATCATGTCAGTACTTTATGTCTGGGCCCAGCTGAACAGAGACATG
  ATTGTATCATTTTGGTTTGGAACACGATTTAAGGCCTGCTATTTACCCTGGGTTATCCTTGGATTCAACT
  ATATCATCGGAGGCTCATACCCAATGGACTTGGGAGGAAGAAATTTTCTATCCACACCTCAGTTTTTGTA
  CCGCTGGCTGCCCAGTAGGAGAGGAGGAGTATCAGGATTTGGTGTGCCCCCTGCTAGCATGAGGCGAGCT
  GCTGATCAGAATGGCGGAGGCGGGAGACACAACTGGGGCCAGGGCTTTCGACTTGGAGACCAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001134671
• ORF Size: 696 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001134671.2, NP_001128143.1
• RefSeq Size: 3284
• RefSeq ORF: 696
• Locus ID: 79139
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Amyotrophic lateral sclerosis (ALS)
• Gene Summary: The protein encoded by this gene is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradation. This protein recognizes substrate in the ER and works in a complex to retrotranslocate it across the ER membrane into the cytosol. This protein may select cystic fibrosis transmembrane conductance regulator protein (CFTR) for degradation as well as unfolded proteins in Alzheimer's disease. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]