TOR2A (NM_001134430) Human Untagged Clone

CAT#: SC325651

TOR2A (untagged)-Human torsin family 2, member A (TOR2A), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TOR2A
• Synonyms: TORP1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001134430, the custom clone sequence may differ by one or more nucleotides
  ATGGCGGCTGCGACGCGCGGCTGCCGGCCCTGGGGCTCGCTCCTCGGGCTGCTCGGGCTG
  GTCTCGGCCGCGGCCGCCGCCTGGGACCTGGCTTCCCTGCGCTGCACCTTGGGCGCCTTT
  TGCGAATGCGACTTCCGGCCCGACTTGCCGGGTCTGGAGTGTGACCTGGCTCAGCACCTG
  GCCGGCCAGCATCTGGCCAAGGCGCTGGTGGTGAAGGCGCTGAAGGCCTTTGTGCGGGAC
  CCAGCCCCCACCAAGCCGCTGGTCCTCTCCCTGCACGGCTGGACCGGCACCGGCAAATCC
  TATGTCAGCTCCCTGCTGGCGCACTACCTCTTCCAGGGCGGCCTCCGCAGCCCCCGCGTG
  CACCACTTTTCTCCCGTCCTCCACTTCCCCCACCCCAGCCACATCGAGCGCTACAAGAAG
  GATCTGAAGAGCTGGGTCCAAGGGAACCTCACTGCCTGTGGCCGCTCCCTCTTCCTCTTC
  GATGAGATGGACAAGATGCCCCCAGGCCTGATGGAAGTCCTGCGGCCTTTCCTGGGCTCC
  TCCTGGGTGGTATACGGGACCAATTACCGCAAAGCCATCTTCATCTTCATCAGATGGCTT
  CTCAAACTCGGGCATCATGGAAGAGCGCCTCCTAGACGCAGTGGTGCCCTTCCTCCCGCT
  CCAGCGGCACCACGTCCGGCACTGCGTGCTCAACGAGCTGGCCCAGCTGGGCCTGGAGCC
  AAGGGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001134430
• ORF Size: 729 bp
• Insert Size: 1460
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001134430.1, NP_001127902.1
• RefSeq Size: 1460
• RefSeq ORF: 729
• Locus ID: 27433
• Protein Families: Secreted Protein, Transmembrane
• Gene Summary: This gene encodes a member of the AAA family of adenosine triphosphatases with similarity to Clp proteases and heat shock proteins. Alternative splicing at this locus results in the translation of multiple isoforms of the encoded protein, some of which contain salusin peptides in the C-terminal region. These peptides may play roles in hypotension, myocardial growth and the induction of mitogenesis, and may also be involved in the pathogenesis of atherosclerosis. The antimicrobial peptide salusin-beta has antibacterial activity. [provided by RefSeq, Nov 2014]
  Transcript Variant: This variant (3) lacks an exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (c) is shorter and has a distinct C-terminus, compared to isoform a.