KCNK17 (NM_001135111) Human Untagged Clone

CAT#: SC325691

KCNK17 (untagged)-Human potassium channel, subfamily K, member 17 (KCNK17), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KCNK17
• Synonyms: K2p17.1; TALK-2; TALK2; TASK-4; TASK4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001135111, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTACCGACCGCGAGCCCGGGCGGCTCCCGAGGGCAGGGTCCGGGGCTGCGCGGTGCCCAGCACCGTGC
  TCCTGCTGCTCGCCTACCTGGCTTACCTGGCGCTGGGCACCGGCGTGTTCTGGACGCTGGAGGGCCGCGC
  GGCGCAGGACTCCAGCCGCAGCTTCCAGCGCGACAAGTGGGAGCTGTTGCAGAACTTCACGTGTCTGGAC
  CGCCCGGCGCTGGACTCGCTGATCCGGGATGTCGTCCAAGCATACAAAAACGGAGCCAGCCTCCTCAGCA
  ACACCACCAGCATGGGGCGCTGGGAGCTCGTGGGCTCCTTCTTCTTTTCTGTGTCCACCATCACCACCAT
  TGGCTATGGCAACCTGAGCCCCAACACGATGGCTGCCCGCCTCTTCTGCATCTTCTTTGCCCTTGTGGGG
  ATCCCACTCAACCTCGTGGTGCTCAACCGACTGGGGCATCTCATGCAGCAGGGAGTAAACCACTGGGCCA
  GCAGGCTGGGGGGCACCTGGCAGGATCCTGACAAGGCGCGGTGGCTGGCGGGCTCTGGCGCCCTCCTCTC
  GGGCCTCCTGCTCTTCCTGCTGCTGCCACCGCTGCTCTTCTCCCACATGGAGGGCTGGAGCTACACAGAG
  GGCTTCTACTTCGCCTTCATCACCCTCAGCACCGTGGGCTTCGGCGACTACGTGATTGCAAGCTGCCTCA
  TTTCAGATACGAGAAAACCAAACAGAGACTGGCAAACACTAGAGCGGACATCGAAATCCTCTGGGGGCTT
  GTTAAAATACAGATTTCTGGCCGGGCACGGTGGCTCACACCTGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001135111
• ORF Size: 816 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001135111.1, NP_001128583.1
• RefSeq Size: 1741
• RefSeq ORF: 816
• Locus ID: 89822
• Protein Families: Druggable Genome, Ion Channels: Potassium, Transmembrane
• Gene Summary: The protein encoded by this gene belongs to the family of potassium channel proteins containing two pore-forming P domains. This channel is an open rectifier which primarily passes outward current under physiological K+ concentrations. This gene is activated at alkaline pH. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
  Transcript Variant: This variant (2) contains an additional exon at the 3' end compared to transcript variant 1. This results in a frame-shift and a shorter isoform (2) with a distinct C-terminus compared to isoform 1.