NR2F2 (NM_001145155) Human Untagged Clone
CAT#: SC325706
NR2F2 (untagged)-Human nuclear receptor subfamily 2, group F, member 2 (NR2F2), transcript variant 2
"NM_001145155" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NR2F2 |
Synonyms | ARP-1; ARP1; CHTD4; COUPTF2; COUPTFB; COUPTFII; NF-E3; SVP40; TFCOUP2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001145155, the custom clone sequence may differ by one or more nucleotides
ATGCAAGCGGTTTGGGACCTTGAACAAGGCAAATATGGTTTTGCGGTGCAGAGGGGCAGGATGCCGCCGA CCCAGCCGACCCACGGGCAGTTCGCGCTGACCAACGGGGATCCCCTCAACTGCCACTCGTACCTGTCCGG ATATATTTCCCTGCTGTTGCGCGCGGAGCCCTATCCCACGTCGCGCTTCGGCAGCCAATGCATGCAGCCC AACAACATCATGGGTATCGAGAACATTTGCGAACTGGCCGCGAGGATGCTCTTCAGCGCCGTCGAGTGGG CCCGGAACATCCCCTTCTTCCCCGACCTGCAGATCACGGACCAGGTGGCCCTGCTTCGCCTCACCTGGAG CGAGCTGTTTGTGTTGAATGCGGCGCAGTGCTCCATGCCCCTCCACGTCGCCCCGCTCCTGGCCGCCGCC GGCCTGCATGCTTCGCCCATGTCCGCCGACCGGGTGGTCGCCTTTATGGACCACATACGGATCTTCCAAG AGCAAGTGGAGAAGCTCAAGGCGCTGCACGTTGACTCAGCCGAGTACAGCTGCCTCAAGGCCATAGTCCT GTTCACCTCAGATGCCTGTGGTCTCTCTGATGTAGCCCATGTGGAAAGCTTGCAGGAAAAGTCTCAGTGT GCTTTGGAAGAATACGTTAGGAGCCAGTACCCCAACCAGCCGACGAGATTCGGAAAGCTTTTGCTTCGCC TCCCTTCCCTCCGCACCGTCTCCTCCTCAGTCATAGAGCAATTGTTTTTCGTCCGTTTGGTAGGTAAAAC CCCCATCGAAACCCTCATCCGGGATATGTTACTGTCCGGCAGCAGTTTTAACTGGCCGTATATGGCAATT CAATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001145155 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001145155.1, NP_001138627.1 |
RefSeq Size | 3869 bp |
RefSeq ORF | 846 bp |
Locus ID | 7026 |
Cytogenetics | 15q26.2 |
Protein Families | Druggable Genome, Nuclear Hormone Receptor, Transcription Factors |
Gene Summary | 'This gene encodes a member of the steroid thyroid hormone superfamily of nuclear receptors. The encoded protein is a ligand inducible transcription factor that is involved in the regulation of many different genes. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]' Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (b) has a shorter and distinct N-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226609 | NR2F2 (Myc-DDK-tagged)-Human nuclear receptor subfamily 2, group F, member 2 (NR2F2), transcript variant 2 |
USD 420.00 |
|
RG226609 | NR2F2 (GFP-tagged) - Human nuclear receptor subfamily 2, group F, member 2 (NR2F2), transcript variant 2 |
USD 460.00 |
|
RC226609L1 | Lenti ORF clone of Human nuclear receptor subfamily 2, group F, member 2 (NR2F2), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC226609L2 | Lenti ORF clone of Human nuclear receptor subfamily 2, group F, member 2 (NR2F2), transcript variant 2, mGFP tagged |
USD 768.00 |
|
RC226609L3 | Lenti ORF clone of Human nuclear receptor subfamily 2, group F, member 2 (NR2F2), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC226609L4 | Lenti ORF clone of Human nuclear receptor subfamily 2, group F, member 2 (NR2F2), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review