KCNK16 (NM_001135106) Human Untagged Clone

CAT#: SC325726

KCNK16 (untagged)-Human potassium channel, subfamily K, member 16 (KCNK16), transcript variant 3


  "NM_001135106" in other vectors (4)

Reconstitution Protocol

USD 660.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "KCNK16"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KCNK16
Synonyms K2p16.1; TALK-1; TALK1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001135106, the custom clone sequence may differ by one or more nucleotides


ATGCCCAGTGCTGGGCTCTGCAGCTGCTGGGGTGGCCGGGTGCTGCCCCTGCTGCTGGCCTATGTCTGCT
ACCTGCTGCTCGGTGCCACTATCTTCCAGCTGCTAGAGAGGCAGGCGGAGGCTCAGTCCAGGGACCAGTT
TCAGTTGGAGAAGCTGCGCTTCCTGGAGAACTACACCTGCCTGGACCAGTGGGCCATGGAGCAGTTTGTG
CAGGTCATCATGGAAGCCTGGGTGAAAGGTGTGAACCCCAAAGGCAACTCTACCAACCCCAGCAACTGGG
ACTTTGGCAGCAGTTTCTTCTTTGCAGGCACAGTCGTCACTACCATAGGATATGGGAACCTGGCACCCAG
CACAGAGGCAGGTCAGGTCTTCTGTGTCTTCTATGCCCTGTTGGGCATCCCGCTTAACGTGATCTTCCTC
AACCACCTGGGCACAGGGCTGCGTGCCCATCTGGCCGCCATTGAAAGATGGGAGGACCGTCCCAGGCGCT
CCCAGGTACTGCAAGTCCTGGGCCTGGCTCTGTTCCTGACCCTGGGGACGCTGGTCATTCTCATCTTCCC
ACCCATGGTCTTCAGCCATGTGGAGGGCTGGAGCTTCAGCGAGGGCTTCTACTTTGCTTTCATCACTCTC
AGCACCATTGGCTTTGGGGACTATGTTGTTGGCACAGACCCCAGCAAGCATTATATCTCAGTGTATCGGA
GCCTGGCAGCCATCTGGATCCTCCTGGGCCTGGCGTGGCTGGCGCTGATCCTCCCACTGGGCCCCCTGCT
TCTGCACAGATGCTGCCAGCTCTGGCTGCTCAGTAGGGGCCTCGGCGTCAAGGATGGGGCAGCCTCTGAC
CCCAGTGGGCTCCCCAGGCCTCAGAAGATCCCCATCTCTGCATGA


Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_001135106
ORF Size 885 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001135106.1, NP_001128578.1
RefSeq Size 947
RefSeq ORF 885
Locus ID 83795
Protein Families Druggable Genome, Ion Channels: Potassium, Transmembrane
Gene Summary The protein encoded by this gene belongs to the family of potassium channel proteins containing two pore-forming P domains. This channel is an open rectifier which primarily passes outward current under physiological K+ concentrations. This gene is expressed predominantly in the pancreas and is activated at alkaline pH. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Sep 2008]
Transcript Variant: This variant (3, also known as TALK-1b) contains an alternative 3' terminal exon compared to transcript variant 1, resulting in a shorter isoform (3) with a distinct C-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.