IKK gamma (IKBKG) (NM_001145255) Human Untagged Clone

CAT#: SC325768

IKBKG (untagged)-Human inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma (IKBKG), transcript variant 4


  "NM_001145255" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "IKBKG"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IKBKG
Synonyms AMCBX1; EDAID1; FIP-3; FIP3; Fip3p; IKK-gamma; IKKAP1; IKKG; IMD33; IP; IP1; IP2; IPD2; NEMO; ZC2HC9
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001145255, the custom clone sequence may differ by one or more nucleotides


ATGAATAGGCACCTCTGGAAGAGCCAACTGTGTGAGATGGTGCAGCCCAGTGGTGGCCCGGCAGCAGATC
AGGACGTACTGGGCGAAGAGTCTCCTCTGGGGAAGCCAGCCATGCTGCACCTGCCTTCAGAACAGGGCGC
TCCTGAGACCCTCCAGCGCTGCCTGGAGGAGAATCAAGAGCTCCGAGATGCCATCCGGCAGAGCAACCAG
ATTCTGCGGGAGCGCTGCGAGGAGCTTCTGCATTTCCAAGCCAGCCAGAGGGAGGAGAAGGAGTTCCTCA
TGTGCAAGTTCCAGGAGGCCAGGAAACTGGTGGAGAGACTCGGCCTGGAGAAGCTCGATCTGAAGAGGCA
GAAGGAGCAGGCTCTGCGGGAGGTGGAGCACCTGAAGAGATGCCAGCAGCAGATGGCTGAGGACAAGGCC
TCTGTGAAAGCCCAGGTGACGTCCTTGCTCGGGGAGCTGCAGGAGAGCCAGAGTCGCTTGGAGGCTGCCA
CTAAGGAATGCCAGGCTCTGGAGGGTCGGAGGAAGCTGGCCCAGTTGCAGGTGGCCTATCACCAGCTCTT
CCAAGAATACGACAACCACATCAAGAGCAGCGTGGTGGGCAGTGAGCGGAAGCGAGCGGATATCTACAAG
GCGGACTTCCAGGCTGAGAGGCAGGCCCGGGAGAAGCTGGCCGAGAAGAAGGAGCTCCTGCAGGAGCAGC
TGGAGCAGCTGCAGAGGGAGTACAGCAAACTGAAGGCCAGCTGTCAGGAGTCGGCCAGGATCGAGGACAT
GAGGAAGCGGCATGTCGAGGTCTCCCAGGCCCCCTTGCCCCCCGCCCCTGCCTACCTCTCCTCTCCCCTG
GCCCTGCCCAGCCAGAGGAGGAGCCCCCCCGAGGAGCCACCTGACTTCTGCTGTCCCAAGTGCCAGTATC
AGGCCCCTGATATGGACACCCTGCAGATACATGTCATGGAGTGCATTGAGTAG


Restriction Sites SgfI-MluI     
ACCN NM_001145255
ORF Size 963 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001145255.2, NP_001138727.1
RefSeq Size 1982
RefSeq ORF 963
Locus ID 8517
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Acute myeloid leukemia, Adipocytokine signaling pathway, Apoptosis, B cell receptor signaling pathway, Chemokine signaling pathway, Chronic myeloid leukemia, Cytosolic DNA-sensing pathway, Epithelial cell signaling in Helicobacter pylori infection, MAPK signaling pathway, NOD-like receptor signaling pathway, Pancreatic cancer, Pathways in cancer, Primary immunodeficiency, Prostate cancer, RIG-I-like receptor signaling pathway, Small cell lung cancer, T cell receptor signaling pathway, Toll-like receptor signaling pathway
Gene Summary This gene encodes the regulatory subunit of the inhibitor of kappaB kinase (IKK) complex, which activates NF-kappaB resulting in activation of genes involved in inflammation, immunity, cell survival, and other pathways. Mutations in this gene result in incontinentia pigmenti, hypohidrotic ectodermal dysplasia, and several other types of immunodeficiencies. A pseudogene highly similar to this locus is located in an adjacent region of the X chromosome. [provided by RefSeq, Mar 2016]
Transcript Variant: This variant (4) lacks two in-frame exons in the central coding region compared to variant 1. The resulting isoform (c) lacks two internal protein segments compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.