PSD93 (DLG2) (NM_001142702) Human Untagged Clone

CAT#: SC325784

DLG2 (untagged)-Human discs, large homolog 2 (Drosophila) (DLG2), transcript variant 4


  "NM_001142702" in other vectors (4)

Reconstitution Protocol

USD 570.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "DLG2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DLG2
Synonyms chapsyn-110; PPP1R58; PSD-93; PSD93
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene SC325784 ORF sequence for NM_001142702, the custom clone sequence may differ by one or more nucleotides


ATGATGAACCACAGCATGAGCTCCGGGTCCGGATCCCTGCGAACCAATCAGAAACGCTCCCTCTACGTCA
GAGCCATGTTCGACTACGACAAGAGCAAGGACAGTGGGCTGCCAAGTCAAGGACTTAGTTTTAAATATGG
AGATATTCTCCACGTTATCAATGCCTCTGATGATGAGTGGTGGCAAGCCAGGAGAGTCATGCTGGAGGGA
GACAGTGAGGAGATGGGGGTCATCCCCAGCAAAAGGAGGGTGGAAAGAAAGGAACGTGCCCGATTGAAGA
CAGTGAAGTTTAATGCCAAACCTGGAGTGATTGATTCGAAAGGGGACATCCCCGGATTAGGTGACGACGG
TTATGGAACAAAGACTCTGAGAGGACAAGAAGACCTCATTCTTTCCTATGAGCCTGTTACAAGGCAGGAA
ATAAACTACACCCGGCCGGTGATTATCCTGGGGCCCATGAAGGATCGGATCAATGACGACTTGATATCTG
AATTCCCTGATAAATTTGGCTCCTGTGTGCCTCATACTACGAGGCCAAAGCGAGACTACGAGGTGGATGG
CAGAGACTATCACTTTGTCATTTCCAGAGAACAAATGGAGAAAGATATCCAAGAGCACAAGTTTATAGAA
GCCGGCCAGTACAATGACAATTTATATGGAACCAGTGTGCAGTCTGTGAGATTTGTAGCAGAAAGAGGCA
AACACTGTATACTTGATGTATCAGGAAATGCTATCAAGCGGTTACAAGTTGCCCAGCTCTATCCCATTGC
CATCTTCATAAAACCCAGGTCTCTGGAACCTCTTATGGAGATGAATAAGCGTCTAACAGAGGAACAAGCC
AAGAAAACCTATGATCGAGCAATTAAGCTAGAACAAGAATTTGGAGAATATTTTACAGCTATTGTCCAAG
GAGATACTTTAGAAGATATATATAACCAATGCAAGCTTGTTATTGAAGAGCAATCTGGGCCTTTCATCTG
GATTCCCTCAAAGGAAAAGTTATAA


Restriction Sites SgfI-MluI     
ACCN NM_001142702
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001142702.1, NP_001136174.1
RefSeq Size 6138 bp
RefSeq ORF 1005 bp
Locus ID 1740
Cytogenetics 11q14.1
Protein Families Druggable Genome
Gene Summary 'This gene encodes a member of the membrane-associated guanylate kinase (MAGUK) family. The encoded protein forms a heterodimer with a related family member that may interact at postsynaptic sites to form a multimeric scaffold for the clustering of receptors, ion channels, and associated signaling proteins. Multiple transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described, but their full-length nature is not known. [provided by RefSeq, Dec 2008]'
Transcript Variant: This variant (4) uses a distinct 5' UTR, lacks an in-frame portion of the 5' coding region, and uses an alternate splice pattern in the central coding region, compared to variant 1. The resulting isoform (4) has a shorter N-terminus and differs at an internal segment, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.