RAD51D (NM_001142571) Human Untagged Clone

CAT#: SC325802

RAD51D (untagged)-Human RAD51-like 3 (S. cerevisiae) (RAD51L3), transcript variant 6

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RAD51D
• Synonyms: BROVCA4; R51H3; RAD51L3; TRAD
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001142571, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGCGTGCTCAGGGTCGGACTGTGCCCTGGCCTTACCGAGGAGATGATCCAGCTTCTCAGGAGCCACA
  GGATCAAGACAGTGGTGGACCTGGTTTCTGCAGACCTGGAAGAGGTAGCTCAGAAATGTGGCTTGTCTTA
  CAAGACATGGAGGGCGCACTCAAGTGGGAACCTGGGAGGACTGCAGCTGCCTCAGGTCCCCGCAGGGAGA
  TCGTGGAGTGGGGTCAGGAATGCTCTGAAGAAGGCAGGACTTGGGCATGGAGGAACAGATGGACTTTCGC
  TGAATGCTTTCGATGAACGAGGCACTGCGGTCAGCACTTCACGTCTTGATAAACTGCTTGATGCTGGTCT
  CTATACTGGAGAAGTGACTGAAATTGTAGGAGGCCCAGGTAGCGGCAAAACTCAGGTATGTCTCTGTATG
  GCAGCAAATGTGGCCCATGGCCTGCAGCAAAACGTCCTATATGTAGATTCCAATGGAGGGCTGACAGCTT
  CCCGCCTCCTCCAGCTGCTTCAGGCTAAAACCCAGGATGAGGAGGAACAGGCAGAAGCTCTCCGGAGGAT
  CCAGGTGGTGCATGCATTTGACATCTTCCAGATGCTGGATGTGCTGCAGGAGCTCCGAGGCACTGTGGCC
  CAGCAGGTGACTGGTTCTTCAGGAACTGTGAAGGTGGTGGTTGTGGACTCGGTCACTGCGGTGGTTTCCC
  CACTTCTGGGAGGTCAGCAGAGGGAAGGCTTGGCCTTGATGATGCAGCTGGCCCGAGAGCTGAAGACCCT
  GGCCCGGGACCTTGGCATGGCAGTGGTGGTGACCAACCACATAACTCGAGACAGGGACAGCGGGAGGCTC
  AAACCTGCCCTCGGACGCTCCTGGAGCTTTGTGCCCAGCACTCGGATTCTCCTGGACACCATCGAGGGAG
  CAGGAGCATCAGGCGGCCGGCGCATGGCGTGTCTGGCCAAATCTTCCCGACAGCCAACAGGTTTCCAGGA
  GATGGTAGACATTGGGACCTGGGGGACCTCAGAGCAGAGTGCCACATTACAGGGTGATCAGACATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001142571
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001142571.1, NP_001136043.1
• RefSeq Size: 2478 bp
• RefSeq ORF: 1047 bp
• Locus ID: 5892
• Cytogenetics: 17q12
• Protein Families: Druggable Genome
• Protein Pathways: Homologous recombination
• Gene Summary: 'The protein encoded by this gene is a member of the RAD51 protein family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51, which are known to be involved in the homologous recombination and repair of DNA. This protein forms a complex with several other members of the RAD51 family, including RAD51L1, RAD51L2, and XRCC2. The protein complex formed with this protein has been shown to catalyze homologous pairing between single- and double-stranded DNA, and is thought to play a role in the early stage of recombinational repair of DNA. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream ring finger and FYVE-like domain containing 1 (RFFL) gene. [provided by RefSeq, Jan 2011]'
  Transcript Variant: This variant (6) lacks an in-frame exon but instead includes a different in-frame exon in the 5' coding region, compared to variant 1. The encoded isoform (6) is longer than isoform 1.