HNT (NTM) (NM_001144058) Human Untagged Clone

CAT#: SC325812

NTM (untagged)-Human neurotrimin (NTM), transcript variant 3


  "NM_001144058" in other vectors (4)

Reconstitution Protocol

USD 600.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NTM
Synonyms CEPU-1; HNT; IGLON2; NTRI
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001144058, the custom clone sequence may differ by one or more nucleotides


ATGGGGGTCTGTGGGTACCTGTTCCTGCCCTGGAAGTGCCTCGTGGTCGTGTCTCTCAGGCTGCTGTTCC
TTGTACCCACAGGAGTGCCCGTGCGCAGCGGAGATGCCACCTTCCCCAAAGCTATGGACAACGTGACGGT
CCGGCAGGGGGAGAGCGCCACCCTCAGGTGCACTATTGACAACCGGGTCACCCGGGTGGCCTGGCTAAAC
CGCAGCACCATCCTCTATGCTGGGAATGACAAGTGGTGCCTGGATCCTCGCGTGGTCCTTCTGAGCAACA
CCCAAACGCAGTACAGCATCGAGATCCAGAACGTGGATGTGTATGACGAGGGCCCTTACACCTGCTCGGT
GCAGACAGACAACCACCCAAAGACCTCTAGGGTCCACCTCATTGTGCAAGTATCTCCCAAAATTGTAGAG
ATTTCTTCAGATATCTCCATTAATGAAGGGAACAATATTAGCCTCACCTGCATAGCAACTGGTAGACCAG
AGCCTACGGTTACTTGGAGACACATCTCTCCCAAAGCGGTTGGCTTTGTGAGTGAAGACGAATACTTGGA
AATTCAGGGCATCACCAGGGAGCAGTCAGGGGACTACGAGTGCAGTGCCTCCAATGACGTGGCCGCGCCC
GTGGTACGGAGAGTAAAGGTCACCGTGAACTATCCACCATACATTTCAGAAGCCAAGGGTACAGGTGTCC
CCGTGGGACAAAAGGGGACACTGCAGTGTGAAGCCTCAGCAGTCCCCTCAGCAGAATTCCAGTGGTACAA
GGATGACAAAAGACTGATTGAAGGAAAGAAAGGGGTGAAAGTGGAAAACAGACCTTTCCTCTCAAAACTC
ATCTTCTTCAATGTCTCTGAACATGACTATGGGAACTACACTTGCGTGGCCTCCAACAAGCTGGGCCACA
CCAATGCCAGCATCATGCTATTTGAAGTGAAAACTACAGCCCTGACCCCTTGGAAAGGTCCAGGCGCCGT
CAGCGAGGTGAGCAACGGCACGTCGAGGAGGGCAGGCTGCGTCTGGCTGCTGCCTCTTCTGGTCTTGCAC
CTGCTTCTCAAATTTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001144058
ORF Size 1068 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001144058.1, NP_001137530.1
RefSeq Size 3408
RefSeq ORF 1068
Locus ID 50863
Protein Families Transmembrane
Gene Summary This gene encodes a member of the IgLON (LAMP, OBCAM, Ntm) family of immunoglobulin (Ig) domain-containing glycosylphosphatidylinositol (GPI)-anchored cell adhesion molecules. The encoded protein may promote neurite outgrowth and adhesion via a homophilic mechanism. This gene is closely linked to a related family member, opioid binding protein/cell adhesion molecule-like (OPCML), on chromosome 11. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]
Transcript Variant: This variant (3) encodes isoform 3. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.