VPS37A (NM_001145152) Human Untagged Clone
CAT#: SC325838
VPS37A (untagged)-Human vacuolar protein sorting 37 homolog A (S. cerevisiae) (VPS37A), transcript variant 2
"NM_001145152" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | VPS37A |
Synonyms | HCRP1; PQBP2; SPG53 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001145152, the custom clone sequence may differ by one or more nucleotides
ATGAGCTGGCTTTTTCCCCTGACCAAGAGCGCCTCCTCCTCCGCGGCTGGGTCCCCCGGTGGCCTCACCA GCCTCCAGCAGCAGAAGCAGCGCCTGATCGAGTCCCTCCGGAACTCACACTCCAGATTGCTTCCTCCACA GTTTCCTCAGGAAAAACCAGTGATCAGTGTTTATCCACCAATACGACATCACTTAATGGATAAACAAGGA GTGTATGTTACCTCTCCATTAGTAAACAATTTTACAATGCACTCAGATCTTGGAAAAATTATTCAGAGTC TGTTGGATGAGTTTTGGAAGAATCCTCCAGTTTTAGCTCCTACTTCAACAGCATTTCCTTATCTATACAG TAACCCAAGTGGGATGTCTCCTTATGCTTCTCAGGGTTTTCCATTTCTTCCTCCATATCCTCCACAAGAA GCAAACAGGAGTATCACTTCTTTATCTGTTGCTGACACTGTTTCTTCTTCAACAACAAGTCATACCACAG CCAAGCCTGCCGCTCCTTCATTTGGTGTCCTTTCAAATCTGCCATTACCCATTCCCACAGTGGATGCTTC AATACCGACAAGCCAAAATGGTTTTGGGTACAAGATGCCAGATGTCCCTGATGCATTTCCAGAACTCTCA GAACTAAGTGTGTCACAACTCACAGATATGAATGAACAAGAGGAGGTATTACTAGAACAGTTTCTGACTT TGCCTCAACTAAAACAAATTATTACCGACAAAGATGACTTAGTAAAAAGTATTGAGGAACTAGCAAGAAA AAATCTCCTTTTGGAGCCCAGCTTGGAAGCCAAAAGACAAACTGTTTTAGATAAGTATGAATTACTTACA CAGATGAAGTCCACTTTCGAAAAGAAGATGCAAAGGCAGCATGAACTTAGTGAGAGCTGTAGTGCAAGTG CCCTTCAGGCAAGATTGAAAGTAGCTGCACATGAAGCTGAGGAAGAATCTGATAATATTGCAGAAGACTT CTTGGAGGGAAAGATGGAAATAGATGATTTTCTCAGTAGCTTCATGGAAAAGAGAACAATTTGCCACTGT AGAAGAGCCAAGGAAGAGAAACTTCAGCAGGCGATAGCAATGCACAGCCAATTTCATGCTCCACTATAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001145152 |
ORF Size | 1119 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001145152.1, NP_001138624.1 |
RefSeq Size | 4510 |
RefSeq ORF | 1119 |
Locus ID | 137492 |
Protein Pathways | Endocytosis |
Gene Summary | This gene belongs to the VPS37 family, and encodes a component of the ESCRT-I (endosomal sorting complex required for transport I) protein complex, required for the sorting of ubiquitinated transmembrane proteins into internal vesicles of multivesicular bodies. Expression of this gene is downregulated in hepatocellular carcinoma, and mutations in this gene are associated with autosomal recessive spastic paraplegia-53. A related pseudogene has been identified on chromosome 5. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2012] Transcript Variant: This variant (2) lacks an exon in the coding region compared to variant 1. The encoded isoform (2) is shorter but has the same N- and C-termini compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227139 | VPS37A (Myc-DDK-tagged)-Human vacuolar protein sorting 37 homolog A (S. cerevisiae) (VPS37A), transcript variant 2 |
USD 98.00 |
|
RG227139 | VPS37A (GFP-tagged) - Human vacuolar protein sorting 37 homolog A (S. cerevisiae) (VPS37A), transcript variant 2 |
USD 460.00 |
|
RC227139L3 | Lenti ORF clone of Human vacuolar protein sorting 37 homolog A (S. cerevisiae) (VPS37A), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC227139L4 | Lenti ORF clone of Human vacuolar protein sorting 37 homolog A (S. cerevisiae) (VPS37A), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review