VPS37A (NM_001145152) Human Untagged Clone

CAT#: SC325838

VPS37A (untagged)-Human vacuolar protein sorting 37 homolog A (S. cerevisiae) (VPS37A), transcript variant 2


  "NM_001145152" in other vectors (4)

Reconstitution Protocol

USD 640.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "VPS37A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol VPS37A
Synonyms HCRP1; PQBP2; SPG53
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001145152, the custom clone sequence may differ by one or more nucleotides


ATGAGCTGGCTTTTTCCCCTGACCAAGAGCGCCTCCTCCTCCGCGGCTGGGTCCCCCGGTGGCCTCACCA
GCCTCCAGCAGCAGAAGCAGCGCCTGATCGAGTCCCTCCGGAACTCACACTCCAGATTGCTTCCTCCACA
GTTTCCTCAGGAAAAACCAGTGATCAGTGTTTATCCACCAATACGACATCACTTAATGGATAAACAAGGA
GTGTATGTTACCTCTCCATTAGTAAACAATTTTACAATGCACTCAGATCTTGGAAAAATTATTCAGAGTC
TGTTGGATGAGTTTTGGAAGAATCCTCCAGTTTTAGCTCCTACTTCAACAGCATTTCCTTATCTATACAG
TAACCCAAGTGGGATGTCTCCTTATGCTTCTCAGGGTTTTCCATTTCTTCCTCCATATCCTCCACAAGAA
GCAAACAGGAGTATCACTTCTTTATCTGTTGCTGACACTGTTTCTTCTTCAACAACAAGTCATACCACAG
CCAAGCCTGCCGCTCCTTCATTTGGTGTCCTTTCAAATCTGCCATTACCCATTCCCACAGTGGATGCTTC
AATACCGACAAGCCAAAATGGTTTTGGGTACAAGATGCCAGATGTCCCTGATGCATTTCCAGAACTCTCA
GAACTAAGTGTGTCACAACTCACAGATATGAATGAACAAGAGGAGGTATTACTAGAACAGTTTCTGACTT
TGCCTCAACTAAAACAAATTATTACCGACAAAGATGACTTAGTAAAAAGTATTGAGGAACTAGCAAGAAA
AAATCTCCTTTTGGAGCCCAGCTTGGAAGCCAAAAGACAAACTGTTTTAGATAAGTATGAATTACTTACA
CAGATGAAGTCCACTTTCGAAAAGAAGATGCAAAGGCAGCATGAACTTAGTGAGAGCTGTAGTGCAAGTG
CCCTTCAGGCAAGATTGAAAGTAGCTGCACATGAAGCTGAGGAAGAATCTGATAATATTGCAGAAGACTT
CTTGGAGGGAAAGATGGAAATAGATGATTTTCTCAGTAGCTTCATGGAAAAGAGAACAATTTGCCACTGT
AGAAGAGCCAAGGAAGAGAAACTTCAGCAGGCGATAGCAATGCACAGCCAATTTCATGCTCCACTATAG


Restriction Sites SgfI-MluI     
ACCN NM_001145152
ORF Size 1119 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001145152.1, NP_001138624.1
RefSeq Size 4510
RefSeq ORF 1119
Locus ID 137492
Protein Pathways Endocytosis
Gene Summary This gene belongs to the VPS37 family, and encodes a component of the ESCRT-I (endosomal sorting complex required for transport I) protein complex, required for the sorting of ubiquitinated transmembrane proteins into internal vesicles of multivesicular bodies. Expression of this gene is downregulated in hepatocellular carcinoma, and mutations in this gene are associated with autosomal recessive spastic paraplegia-53. A related pseudogene has been identified on chromosome 5. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2012]
Transcript Variant: This variant (2) lacks an exon in the coding region compared to variant 1. The encoded isoform (2) is shorter but has the same N- and C-termini compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.