CHRDL1 (NM_001143983) Human Untagged Clone

CAT#: SC325846

CHRDL1 (untagged)-Human chordin-like 1 (CHRDL1), transcript variant 4


  "NM_001143983" in other vectors (4)

Reconstitution Protocol

USD 650.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CHRDL1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CHRDL1
Synonyms CHL; dA141H5.1; MGC1; MGCN; NRLN1; VOPT
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001143983, the custom clone sequence may differ by one or more nucleotides


ATGAGAAAAAAGTGGAAAATGGGAGGCATGAAATACATCTTTTCGTTGTTGTTCTTTCTTTTGCTAGAAG
GAGGCAAAACAGAGCAAGTAAAACATTCAGAGACATATTGCATGTTTCAAGACAAGAAGTACAGAGTGGG
TGAGAGATGGCATCCTTACCTGGAACCTTATGGGTTGGTTTACTGCGTGAACTGCATCTGCTCAGAGAAT
GGGAATGTGCTTTGCAGCCGAGTCAGATGTCCAAATGTTCATTGCCTTTCTCCTGTGCATATTCCTCATC
TGTGCTGCCCTCGCTGCCCAGGAGATGGAGAACTGTCATGGGAACATTCTGATGGTGATATCTTCCGGCA
ACCTGCCAACAGAGAAGCAAGACATTCTTACCACCGCTCTCACTATGATCCTCCACCAAGCCGACAGGCT
GGAGGTCTGTCCCGCTTTCCTGGGGCCAGAAGTCACCGGGGAGCTCTTATGGATTCCCAGCAAGCATCAG
GAACCATTGTGCAAATTGTCATCAATAACAAACACAAGCATGGACAAGTGTGTGTTTCCAATGGAAAGAC
CTATTCTCATGGCGAGTCCTGGCACCCAAACCTCCGGGCATTTGGCATTGTGGAGTGTGTGCTATGTACT
TGTAATGTCACCAAGCAAGAGTGTAAGAAAATCCACTGCCCCAATCGATACCCCTGCAAGTATCCTCAAA
AAATAGACGGAAAATGCTGCAAGGTGTGTCCAGGTAAAAAAGCAAAAGAAGAACTTCCAGGCCAAAGCTT
TGACAATAAAGGCTACTTCTGCGGGGAAGAAACGATGCCTGTGTATGAGTCTGTATTCATGGAGGATGGG
GAGACAACCAGAAAAATAGCACTGGAGACTGAGAGACCACCTCAGGTAGAGGTCCACGTTTGGACTATTC
GAAAGGGCATTCTCCAGCACTTCCATATTGAGAAGATCTCCAAGAGGATGTTTGAGGAGCTTCCTCACTT
CAAGCTGGTGACCAGAACAACCCTGAGCCAGTGGAAGATCTTCACCGAAGGAGAAGCTCAGATCAGCCAG
ATGTGTTCAAGTCGTGTATGCAGAACAGAGCTTGAAGATTTAGTCAAGGTTTTGTACCTGGAGAGATCTG
AAAAGGGCCACTGTTAG


Restriction Sites SgfI-MluI     
ACCN NM_001143983
ORF Size 1137 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001143983.2, NP_001137455.2
RefSeq Size 3879
RefSeq ORF 1137
Locus ID 91851
Protein Families ES Cell Differentiation/IPS, Secreted Protein
Gene Summary This gene encodes an antagonist of bone morphogenetic protein 4. The encoded protein may play a role in topographic retinotectal projection and in the regulation of retinal angiogenesis in response to hypoxia. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jan 2009]
Transcript Variant: This variant (4) lacks two alternate exons, resulting in the loss of an in-frame segment in the central coding region, compared to variant 1. The resulting protein (isoform 4) is shorter but has the identical N- and C-termini compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.