RBFOX1 (NM_001142334) Human Untagged Clone
CAT#: SC325878
RBFOX1 (untagged)-Human RNA binding protein, fox-1 homolog (C. elegans) 1 (RBFOX1), transcript variant 6
"NM_001142334" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RBFOX1 |
Synonyms | 2BP1; A2BP1; FOX-1; FOX1; HRNBP1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001142334, the custom clone sequence may differ by one or more nucleotides
ATGAATTGTGAAAGAGAGCAGCTAAGGGGTAATCAGGAAGCAGCCGCTGCCCCTGACACAATGGCTCAGC CTTACGCTTCGGCCCAGTTTGCTCCCCCGCAGAACGGTATCCCCGCGGAATACACGGCCCCTCATCCCCA CCCCGCGCCAGAGTACACAGGCCAGACCACGGTTCCCGAGCACACATTAAACCTGTACCCTCCCGCCCAG ACGCACTCCGAGCAGAGCCCGGCGGACACGAGCGCTCAGACCGTCTCTGGCACCGCCACACAGACAGATG ACGCAGCACCGACGGATGGCCAGCCCCAGACACAACCTTCTGAAAACACGGAAAACAAGTCTCAGCCCAA GCGGCTGCATGTCTCCAATATCCCCTTCAGGTTCCGGGATCCGGACCTCAGACAAATGTTTGGTCAATTT GGTAAAATCTTAGATGTTGAAATTATTTTTAATGAGCGAGGCTCAAAGGGATTTGGTTTCGTAACTTTCG AAAATAGTGCCGATGCGGACAGGGCGAGGGAGAAATTACACGGCACCGTGGTAGAGGGCCGTAAAATCGA GGTAAATAATGCCACAGCACGTGTAATGACAAATAAAAAGACCGTCAACCCTTATACAAATGGCTGGAAA TTGAATCCAGTTGTGGGTGCAGTCTACAGTCCCGAATTCTATGCAGGCACGGTCCTGTTGTGCCAGGCCA ACCAGGAGGGATCTTCCATGTACAGTGCCCCCAGTTCACTTGTATATACTTCTGCAATGCCAGGCTTCCC GTATCCAGCAGCCACCGCCGCGGCCGCCTACCGAGGGGCGCACCTGCGAGGCCGCGGTCGCACCGTGTAC AACACCTTCAGGGCCGCGGCGCCCCCGCCCCCGATCCCGGCCTACGGCGGTGTTGTTTACCAGGATGGAT TTTATGGTGCAGACATTTATGGTGGTTATGCTGCATACCGCTACGCCCAGCCTACCCCTGCCACTGCCGC TGCCTACAGTGACAGTTACGGACGAGTTTATGCTGCCGACCCCTACCACCACGCACTTGCTCCAGCCCCC ACCTACGGCGTTGGTGCCATGAATGCTTTTGCACCTTTGACTGATGCCAAGACTAGGAGCCATGCTGATG ATGTGGGTCTCGTTCTTTCTTCATTGCAGGCTAGTATATACCGAGGGGGATACAACCGTTTTGCTCCATA CTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001142334 |
ORF Size | 1194 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001142334.1, NP_001135806.1 |
RefSeq Size | 4007 |
RefSeq ORF | 1194 |
Locus ID | 54715 |
Gene Summary | The Fox-1 family of RNA-binding proteins is evolutionarily conserved, and regulates tissue-specific alternative splicing in metazoa. Fox-1 recognizes a (U)GCAUG stretch in regulated exons or in flanking introns. The protein binds to the C-terminus of ataxin-2 and may contribute to the restricted pathology of spinocerebellar ataxia type 2 (SCA2). Ataxin-2 is the product of the SCA2 gene which causes familial neurodegenerative diseases. Fox-1 and ataxin-2 are both localized in the trans-Golgi network. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011] Transcript Variant: This variant (6) differs in the 5' UTR and lacks an in-frame section of the 3' coding region, compared to variant 1. This results in a shorter isoform (4) with an alternate N-terminus compared to isoform 1. Variants 4 and 6 both encode isoform 4. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226569 | RBFOX1 (Myc-DDK-tagged)-Human RNA binding protein, fox-1 homolog (C. elegans) 1 (RBFOX1), transcript variant 6 |
USD 420.00 |
|
RG226569 | RBFOX1 (GFP-tagged) - Human RNA binding protein, fox-1 homolog (C. elegans) 1 (RBFOX1), transcript variant 6 |
USD 460.00 |
|
RC226569L1 | Lenti ORF clone of Human RNA binding protein, fox-1 homolog (C. elegans) 1 (RBFOX1), transcript variant 6, Myc-DDK-tagged |
USD 620.00 |
|
RC226569L2 | Lenti ORF clone of Human RNA binding protein, fox-1 homolog (C. elegans) 1 (RBFOX1), transcript variant 6, mGFP tagged |
USD 620.00 |
|
RC226569L3 | Lenti ORF clone of Human RNA binding protein, fox-1 homolog (C. elegans) 1 (RBFOX1), transcript variant 6, Myc-DDK-tagged |
USD 620.00 |
|
RC226569L4 | Lenti ORF clone of Human RNA binding protein, fox-1 homolog (C. elegans) 1 (RBFOX1), transcript variant 6, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review