CRF1 (CRHR1) (NM_001145148) Human Untagged Clone
CAT#: SC325884
CRHR1 (untagged)-Human corticotropin releasing hormone receptor 1 (CRHR1), transcript variant 4
"NM_001145148" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CRHR1 |
Synonyms | CRF-R; CRF-R-1; CRF-R1; CRF1; CRFR-1; CRFR1; CRH-R-1; CRH-R1; CRHR; CRHR1L |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001145148, the custom clone sequence may differ by one or more nucleotides
ATGGGAGGGCACCCGCAGCTCCGTCTCGTCAAGGCCCTTCTCCTTCTGGGGCTGAACCCCGTCTCTGCCT CCCTCCAGGACCAGCACTGCGAGAGCCTGTCCCTGGCCAGCAACATCTCAGGACTGCAGTGCAACGCATC CGTGGACCTCATTGGCACCTGCTGGCCCCGCAGCCCTGCGGGGCAGCTAGTGGTTCGGCCCTGCCCTGCC TTTTTCTATGGTGTCCGCTACAATACCACAAACAATGGCTACCGGGAGTGCCTGGCCAATGGCAGCTGGG CCGCCCGCGTGAATTACTCCGAGTGCCAGGAGATCCTCAATGAGGAGAAAAAAAGCAAGGTGCACTACCA TGTCGCAGTCATCATCAACTACCTGGGCCACTGTATCTCCCTGGTGGCCCTCCTGGTGGCCTTTGTCCTC TTTCTGCGGCTCAGGAGCATCCGGTGCCTGCGAAACATCATCCACTGGAACCTCATCTCCGCCTTCATCC TGCGCAACGCCACCTGGTTCGTGGTCCAGCTAACCATGAGCCCCGAGGTCCACCAGAGCAACGTGGGCTG GTGCAGGTTGGTGACAGCCGCCTACAACTACTTCCATGTGACCAACTTCTTCTGGATGTTCGGCGAGGGC TGCTACCTGCACACAGCCATCGTGCTCACCTACTCCACTGACCGGCTGCGCAAATGGATGTTCATCTGCA TTGGCTGGGGTGTGCCCTTCCCCATCATTGTGGCCTGGGCCATTGGGAAGCTGTACTACGACAATGAGAA GTGCTGGTTTGGCAAAAGGCCTGGGGTGTACACCGACTACATCTACCAGGGCCCCATGATCCTGGTCCTG CTGATCAATTTCATCTTCCTTTTCAACATCGTCCGCATCCTCATGACCAAGCTCCGGGCATCCACCACGT CTGAGACCATTCAGTACAGGAAGGCTGTGAAAGCCACTCTGGTGCTGCTGCCCCTCCTGGGCATCACCTA CATGCTGTTCTTCGTCAATCCCGGGGAGGATGAGGTCTCCCGGGTCGTCTTCATCTACTTCAACTCCTTC CTGGAATCCTTCCAGGTCCGTTCTGCCATCCGGAAGAGGTGGCACCGGTGGCAGGACAAGCACTCGATCC GTGCCCGAGTGGCCCGTGCCATGTCCATCCCCACCTCCCCAACCCGTGTCAGCTTTCACAGCATCAAGCA GTCCACAGCAGTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001145148 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001145148.1, NP_001138620.1 |
RefSeq Size | 2552 bp |
RefSeq ORF | 1206 bp |
Locus ID | 1394 |
Cytogenetics | 17q21.31 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Protein Pathways | Long-term depression, Neuroactive ligand-receptor interaction |
Gene Summary | 'This gene encodes a G-protein coupled receptor that binds neuropeptides of the corticotropin releasing hormone family that are major regulators of the hypothalamic-pituitary-adrenal pathway. The encoded protein is essential for the activation of signal transduction pathways that regulate diverse physiological processes including stress, reproduction, immune response and obesity. Alternative splicing results in multiple transcript variants. Naturally-occurring readthrough transcription between this gene and upstream GeneID:147081 results in transcripts that encode isoforms that share similarity with the products of this gene. [provided by RefSeq, Aug 2016]' Transcript Variant: This variant (1d, also known as CRH-R1d), lacks an alternate in-frame exon in both the central and 3' coding regions, compared to variant. The encoded isoform (4) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226962 | CRHR1 (Myc-DDK-tagged)-Human corticotropin releasing hormone receptor 1 (CRHR1), transcript variant 4 |
USD 420.00 |
|
RG226962 | CRHR1 (GFP-tagged) - Human corticotropin releasing hormone receptor 1 (CRHR1), transcript variant 4 |
USD 460.00 |
|
RC226962L3 | Lenti ORF clone of Human corticotropin releasing hormone receptor 1 (CRHR1), transcript variant 4, Myc-DDK-tagged |
USD 620.00 |
|
RC226962L4 | Lenti ORF clone of Human corticotropin releasing hormone receptor 1 (CRHR1), transcript variant 4, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review